ID: 1053296909

View in Genome Browser
Species Human (GRCh38)
Location 9:36921955-36921977
Sequence CTTACTCCAGATGGGCTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053296901_1053296909 8 Left 1053296901 9:36921924-36921946 CCCCCTCGGACACCTGTGGGGTC No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data
1053296903_1053296909 6 Left 1053296903 9:36921926-36921948 CCCTCGGACACCTGTGGGGTCAG No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data
1053296906_1053296909 -4 Left 1053296906 9:36921936-36921958 CCTGTGGGGTCAGCAAAGGCTTA No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data
1053296904_1053296909 5 Left 1053296904 9:36921927-36921949 CCTCGGACACCTGTGGGGTCAGC No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data
1053296897_1053296909 21 Left 1053296897 9:36921911-36921933 CCAGGGGAGGGGACCCCCTCGGA No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data
1053296902_1053296909 7 Left 1053296902 9:36921925-36921947 CCCCTCGGACACCTGTGGGGTCA No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053296909 Original CRISPR CTTACTCCAGATGGGCTCCC CGG Intronic