ID: 1053297290

View in Genome Browser
Species Human (GRCh38)
Location 9:36923982-36924004
Sequence ATGAATAAACTGAGGCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053297285_1053297290 1 Left 1053297285 9:36923958-36923980 CCATTCCAAATCCTCATTTCACA 0: 1
1: 0
2: 4
3: 39
4: 374
Right 1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG No data
1053297287_1053297290 -10 Left 1053297287 9:36923969-36923991 CCTCATTTCACAGATGAATAAAC 0: 1
1: 50
2: 625
3: 2809
4: 7575
Right 1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG No data
1053297286_1053297290 -4 Left 1053297286 9:36923963-36923985 CCAAATCCTCATTTCACAGATGA 0: 1
1: 5
2: 23
3: 164
4: 699
Right 1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053297290 Original CRISPR ATGAATAAACTGAGGCTCAA GGG Intronic
No off target data available for this crispr