ID: 1053302706

View in Genome Browser
Species Human (GRCh38)
Location 9:36963163-36963185
Sequence GCAGATTAACCAGAAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053302701_1053302706 15 Left 1053302701 9:36963125-36963147 CCATCTCTCCTCATTAAAACACA 0: 1
1: 1
2: 1
3: 47
4: 501
Right 1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG No data
1053302698_1053302706 30 Left 1053302698 9:36963110-36963132 CCGTCTCCTCACCTTCCATCTCT 0: 1
1: 0
2: 20
3: 216
4: 1911
Right 1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG No data
1053302699_1053302706 24 Left 1053302699 9:36963116-36963138 CCTCACCTTCCATCTCTCCTCAT 0: 1
1: 0
2: 14
3: 84
4: 718
Right 1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG No data
1053302700_1053302706 19 Left 1053302700 9:36963121-36963143 CCTTCCATCTCTCCTCATTAAAA 0: 1
1: 1
2: 1
3: 42
4: 384
Right 1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG No data
1053302703_1053302706 7 Left 1053302703 9:36963133-36963155 CCTCATTAAAACACATTACAGGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053302706 Original CRISPR GCAGATTAACCAGAAAACAC TGG Intronic
No off target data available for this crispr