ID: 1053304525

View in Genome Browser
Species Human (GRCh38)
Location 9:36974820-36974842
Sequence CGTCGAGGCCTCGGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053304525_1053304531 -4 Left 1053304525 9:36974820-36974842 CCTGAGCCCCCGAGGCCTCGACG 0: 1
1: 0
2: 0
3: 14
4: 110
Right 1053304531 9:36974839-36974861 GACGACCTGCCCCTCTAGTCAGG No data
1053304525_1053304532 -3 Left 1053304525 9:36974820-36974842 CCTGAGCCCCCGAGGCCTCGACG 0: 1
1: 0
2: 0
3: 14
4: 110
Right 1053304532 9:36974840-36974862 ACGACCTGCCCCTCTAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053304525 Original CRISPR CGTCGAGGCCTCGGGGGCTC AGG (reversed) Intronic
900129812 1:1082622-1082644 GATCGAGGCCTTGGGGGGTCCGG - Exonic
900292296 1:1928693-1928715 CTTCGAGTCCTGGGGGGCTCCGG - Intronic
900314903 1:2051642-2051664 CGTCCCTGCCTCTGGGGCTCAGG - Intronic
900422698 1:2562452-2562474 CGGGGAGGTCTCGGGGCCTCAGG + Intronic
900841489 1:5052094-5052116 AGTCAAGGCCTCGGGGGTTTTGG - Intergenic
901206739 1:7501904-7501926 GCTGGAGGCCTCAGGGGCTCAGG - Intronic
901746399 1:11376671-11376693 GGTGGAGGCCTTGGAGGCTCTGG + Intergenic
902850087 1:19148479-19148501 CTTCGAGGCCTCAGGGCCTCGGG + Intronic
912492670 1:110070625-110070647 CGCACAGGCCTCCGGGGCTCCGG + Exonic
915977502 1:160400658-160400680 CCTCAAGGCCCCGGGGGCTGGGG - Exonic
916761292 1:167820185-167820207 CGTCGCAGCCTCGGGAGCTGCGG - Intronic
919878876 1:201889277-201889299 GGCAGAGGCCTCGGGGGCTCTGG + Intronic
920920328 1:210292768-210292790 CGACGACGCCTCGGAGGATCCGG - Intergenic
924931570 1:248737113-248737135 TGTGGAGGCCTCCTGGGCTCTGG + Intronic
1065024376 10:21526579-21526601 CGTCGAGGGCTCTCGGGCTCCGG - Intergenic
1066758208 10:38730880-38730902 CGGCGCAGCCTCGGAGGCTCAGG + Intergenic
1067572925 10:47384659-47384681 CGCCGAGGCCCCGCGGGCCCAGG - Intergenic
1070986603 10:80695065-80695087 CGGGGAGGCCTCGGGTGCTGGGG + Intergenic
1076299669 10:129415477-129415499 TGTCAAGGCCCCTGGGGCTCAGG - Intergenic
1076349796 10:129808134-129808156 CCTTGAGGCCTCGGGGGCCTGGG - Intergenic
1077158820 11:1103474-1103496 CGTGGGGGCCTCGGGGGCCATGG - Intergenic
1077179793 11:1207187-1207209 CCTGCAGGCCCCGGGGGCTCAGG + Intergenic
1079367732 11:19823765-19823787 TGTCGGGGACTCGGGGGCTAGGG + Intronic
1083459216 11:62799674-62799696 CGTGGAGGCCACGGGGGCATAGG - Intronic
1084334090 11:68446820-68446842 CGTCGAGGGGCCGGGGGCTTGGG + Intronic
1090274859 11:125412012-125412034 AGTCCAGGCCAGGGGGGCTCAGG + Intronic
1092246647 12:6867752-6867774 CCTCGGGGCCTCGGGGCCTCGGG - Intronic
1102039135 12:109789375-109789397 CTTAGAGGTCTTGGGGGCTCTGG + Intronic
1102612092 12:114121319-114121341 CATCGTGGGCTCGGTGGCTCAGG - Intergenic
1103321162 12:120093580-120093602 GGTCTAGGCCCCTGGGGCTCAGG - Exonic
1105492583 13:20902863-20902885 CGTCGCGGCCTCGGCGGGTCTGG + Intronic
1106720126 13:32427922-32427944 CTGCGAGGCCTCCCGGGCTCCGG - Exonic
1109188473 13:59297681-59297703 TGTCGAGGGCTGGGGGGCTAGGG + Intergenic
1115610751 14:35046574-35046596 CGTCGCAGCCTCGGGAGCTGCGG + Exonic
1117174744 14:53134563-53134585 GGTCGAGGCCTCGGTGGTTCTGG - Intronic
1119709638 14:76812576-76812598 GGTCCAGGCCTCGTGGGGTCAGG + Intronic
1122972455 14:105157972-105157994 CCTCCAGGCCACGCGGGCTCAGG + Intronic
1123014648 14:105367898-105367920 CTTGGGGGACTCGGGGGCTCGGG + Intronic
1124377089 15:29135199-29135221 CCTGGAGGCCTCGGGGACTGGGG - Intronic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1131215238 15:90530342-90530364 CGCCGAGGCCGCGGCCGCTCCGG - Intronic
1132339567 15:101069344-101069366 GGCCCAGGCCTCGGGGACTCAGG - Exonic
1132619256 16:856591-856613 GGTCAAGGCCTAGGGGGCCCAGG + Intronic
1132815962 16:1826702-1826724 CGCCGAGGCCTCGGTGGGTGCGG - Exonic
1132891349 16:2206294-2206316 GGTGGAGGCCTGGGGGGCCCTGG + Intronic
1138572417 16:57884330-57884352 GGTGGAGACCCCGGGGGCTCGGG + Exonic
1141694608 16:85613615-85613637 GGGCGGGGACTCGGGGGCTCCGG + Intronic
1142810560 17:2393796-2393818 CGCCGAGGCTGCAGGGGCTCGGG + Intronic
1143118341 17:4592973-4592995 GGACGAGGCCTGGGGGGATCTGG - Exonic
1143554426 17:7651671-7651693 GGGCGACGCCTCGGGGGCGCAGG + Intronic
1143864155 17:9911730-9911752 CCTTGAGGCCCCGGGGGCTCAGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147793165 17:43025575-43025597 CGGGGAGGCCTTGAGGGCTCAGG + Intronic
1149420924 17:56510552-56510574 GGTCCAGGTCTCTGGGGCTCAGG - Intronic
1152932375 17:83116379-83116401 CCTCGAGGCCTCGTGGGGCCGGG + Intergenic
1153805127 18:8704714-8704736 CCCCGTGGCCTCGGGAGCTCAGG - Intergenic
1153839129 18:8990452-8990474 CTTGGAGCCCTCGGGAGCTCAGG + Intergenic
1153921791 18:9798244-9798266 CGTCGAGGGCTGGGGAGATCAGG - Intronic
1160540114 18:79616740-79616762 CGTGGAGGCCGCCGGGGCCCGGG + Intergenic
1160733572 19:651871-651893 GGGCGTGACCTCGGGGGCTCAGG + Intronic
1162957609 19:14107807-14107829 GATGGAGGCCTCGGGGGCTCGGG + Intronic
1164992501 19:32694360-32694382 GGTCTAGGCCTCGGGGGTTTTGG + Intronic
1165995502 19:39840706-39840728 CGTGGAGGCCGAGGGGGCTTTGG - Exonic
1166765603 19:45251161-45251183 GGTCGGGGCGCCGGGGGCTCCGG - Intronic
1167757407 19:51421437-51421459 AGTCGGGGCGTCGGGGGCTCTGG - Intergenic
926267990 2:11344083-11344105 CGGCGCGGTCTCGGGGGCGCCGG + Exonic
928024431 2:27728345-27728367 GATGGAGGCCTCTGGGGCTCTGG + Intergenic
931540838 2:63327524-63327546 AGTCTAGGCCTCGGGGGTTTTGG - Intronic
933847399 2:86337217-86337239 CGGCGAGGGCTGGGGCGCTCGGG - Intronic
940463425 2:153997789-153997811 TGTCGGGGGCTCGGGGGCTAGGG - Intronic
944632677 2:201643097-201643119 CGTCGTGGCAACGCGGGCTCAGG + Intronic
944743524 2:202634855-202634877 TCTCAAGGCCTCGGGGGCCCGGG + Intergenic
948456479 2:238106800-238106822 CGGGCAGGCCTCGGGGTCTCAGG + Intronic
948837040 2:240630904-240630926 GGGCCAGGTCTCGGGGGCTCCGG + Exonic
949014387 2:241701551-241701573 GGCTGAGGCCCCGGGGGCTCGGG + Intergenic
1168797838 20:623259-623281 CGTCAGGGCCTCTGGGGCACTGG - Intergenic
1168904524 20:1392748-1392770 CGTCGAGGCCTGGGGGCCCGGGG - Intronic
1169211139 20:3766990-3767012 CCTTGGGGCCTCGGGGGCTTGGG - Intronic
1172628986 20:36365833-36365855 GGTCCAGGTCTAGGGGGCTCTGG - Intronic
1173166499 20:40690017-40690039 CCCCGAGGCTCCGGGGGCTCAGG - Intergenic
1173641971 20:44609731-44609753 AGCCGAGGACTCGGAGGCTCCGG + Intronic
1175429198 20:58890649-58890671 CGCAGAGGCCGCGGGCGCTCCGG + Intronic
1175429280 20:58890998-58891020 GGAGGAGGCCTCGGGGGCGCCGG + Intronic
1175545439 20:59775110-59775132 CCTTGAGGACTCCGGGGCTCGGG + Intronic
1176139908 20:63540414-63540436 GGTAGAAGCCTCGGAGGCTCTGG - Intergenic
1178739299 21:35182930-35182952 TGTCGAGGACTGGGGGGCTAGGG - Intronic
1179576040 21:42309079-42309101 CGTTGAGGCCACCTGGGCTCTGG + Intergenic
1180959380 22:19755698-19755720 GGACGCGGCCTCGGGGTCTCGGG - Intergenic
1181007557 22:20021181-20021203 CGGCCTGGGCTCGGGGGCTCCGG + Intronic
1182532160 22:30969044-30969066 CGCGGAGGCCTCGGGGGCTTGGG - Intergenic
1183406007 22:37631012-37631034 TGCGGAGGCCTGGGGGGCTCTGG - Exonic
951844179 3:27067886-27067908 CCTAGAGGCCACAGGGGCTCAGG - Intergenic
954105950 3:48409984-48410006 CTCCGAGGCCTGGGCGGCTCCGG + Exonic
954540749 3:51391687-51391709 CGGCAAGGCCTCGGGGGACCCGG + Exonic
954714664 3:52521097-52521119 CGTCCAGGGCTGGGGAGCTCTGG + Intronic
962230516 3:133661771-133661793 CGTTGGAGCCTCGGGGTCTCCGG + Exonic
969425468 4:7121514-7121536 GCTCCAAGCCTCGGGGGCTCGGG - Intergenic
974734451 4:65911700-65911722 CCTCGAGGCCTCGGGCAATCTGG + Intergenic
977885004 4:102244345-102244367 CGTCTAGGCCTCGGCGGTTTTGG - Intergenic
985647438 5:1091572-1091594 CCTTGAGGCCTCATGGGCTCAGG - Intronic
991161938 5:63513274-63513296 TGTCGAGGGCTGGGGGGCTTGGG + Intergenic
994083214 5:95731181-95731203 CGCGGAGGCCCCGGGAGCTCCGG - Exonic
997443099 5:133922573-133922595 GGGAGAGGCCTCGGGAGCTCAGG + Intergenic
1002133602 5:177095594-177095616 GGTCGGGGCCTGGGGGGCGCCGG - Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1006923922 6:37643900-37643922 CATCGAGGCCTCGGGAGCTGGGG - Exonic
1014632569 6:123804081-123804103 TGCCGAGGGCTCGGGGGCTCCGG - Intergenic
1014724967 6:124962626-124962648 CCCTGAGGCCTCGGGGGCTCAGG - Exonic
1018936834 6:168279269-168279291 CGACGAGGCCTCTGGGGTGCTGG - Intergenic
1019183397 6:170207149-170207171 AGTCCAGGCCTCGGAGGCTGTGG - Intergenic
1019539531 7:1545542-1545564 GGGCAAGGCCTGGGGGGCTCAGG - Exonic
1020099968 7:5389115-5389137 CGAGGAGGCCTCGGGGCCACGGG - Exonic
1029496107 7:100896033-100896055 CGTCTGGGCCCCGGGGTCTCCGG - Intronic
1030194266 7:106837534-106837556 AGTCGAGGCCTCGGTGGTTTTGG - Intergenic
1036707320 8:11055422-11055444 GGTCGGGGCCTTGAGGGCTCAGG + Intronic
1038319533 8:26514310-26514332 CGGCCATGGCTCGGGGGCTCGGG - Intronic
1040545892 8:48397439-48397461 CGCAGAGGCCTCGTGGGCCCTGG + Intergenic
1053304525 9:36974820-36974842 CGTCGAGGCCTCGGGGGCTCAGG - Intronic
1055537323 9:77262579-77262601 TGTCGAGGGGTCGGGGGCTAGGG - Intronic
1059433679 9:114264351-114264373 CGTCCGGTCCTCGGGGGCCCTGG - Exonic
1062390229 9:136330949-136330971 CCTTGAGGCCTTGTGGGCTCAGG - Intronic
1062531156 9:137001025-137001047 CGGCGAGACCTCGGGGGCGGCGG + Intergenic
1196660441 X:118263768-118263790 CATCGAGGGCTAAGGGGCTCTGG + Intergenic
1196965118 X:121047437-121047459 CGGCGAGGCCGCGGCGGGTCCGG + Intergenic
1200213160 X:154355846-154355868 CGTGGAGGCTTGGGGGGCTGTGG + Intronic