ID: 1053305307

View in Genome Browser
Species Human (GRCh38)
Location 9:36980596-36980618
Sequence TCCCCCAACCCTTCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053305307_1053305314 27 Left 1053305307 9:36980596-36980618 CCAGACACAGAAGGGTTGGGGGA 0: 1
1: 0
2: 5
3: 68
4: 262
Right 1053305314 9:36980646-36980668 CAGTGTAGAGACCCTGTTGGAGG No data
1053305307_1053305311 1 Left 1053305307 9:36980596-36980618 CCAGACACAGAAGGGTTGGGGGA 0: 1
1: 0
2: 5
3: 68
4: 262
Right 1053305311 9:36980620-36980642 GAGGGTCATACAGTCTAATCTGG No data
1053305307_1053305313 24 Left 1053305307 9:36980596-36980618 CCAGACACAGAAGGGTTGGGGGA 0: 1
1: 0
2: 5
3: 68
4: 262
Right 1053305313 9:36980643-36980665 CCACAGTGTAGAGACCCTGTTGG No data
1053305307_1053305315 28 Left 1053305307 9:36980596-36980618 CCAGACACAGAAGGGTTGGGGGA 0: 1
1: 0
2: 5
3: 68
4: 262
Right 1053305315 9:36980647-36980669 AGTGTAGAGACCCTGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053305307 Original CRISPR TCCCCCAACCCTTCTGTGTC TGG (reversed) Intronic
900552046 1:3261711-3261733 TCCTCCACTCCTCCTGTGTCAGG + Intronic
900623730 1:3598843-3598865 TCCCCCACCCCTTCCTTCTCAGG + Intronic
901358838 1:8677616-8677638 TCCCCTCACCCTTCTCTGTAGGG + Intronic
902337969 1:15764803-15764825 ACCCCCACCCCTTCTCTGGCTGG + Intronic
902403987 1:16173181-16173203 TCCCCCACCCCTCCTCTGCCAGG - Intergenic
902659189 1:17889598-17889620 TCCCCCACCCCTTCTGTCTCAGG - Intergenic
903662400 1:24986262-24986284 TACCCCAACGCCTCTGTTTCAGG + Intergenic
904392970 1:30197861-30197883 TCCCTCATCCCTTCTGTCTCTGG - Intergenic
904392992 1:30197988-30198010 TCCCTCATCCCCTCTGTCTCTGG - Intergenic
904393058 1:30198333-30198355 TCCCTCCTCCCTTCTGTCTCTGG - Intergenic
904455705 1:30646891-30646913 TCCCACAGCCCTGCAGTGTCTGG - Intergenic
906466598 1:46086794-46086816 TCAGCCAACTCTTCTGTTTCTGG - Intronic
906504586 1:46369038-46369060 TACCCCAATGCTTCTGGGTCAGG + Intergenic
907505984 1:54918587-54918609 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
907602867 1:55787976-55787998 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
910611251 1:89144890-89144912 TCCTCCTACCCCTCTCTGTCTGG + Intronic
911727637 1:101258469-101258491 TCCCCCAGCTCTTCTGAGTTTGG - Intergenic
912793729 1:112676807-112676829 TCCCCAAACCCTTCAGTCTTAGG - Intronic
914502969 1:148263822-148263844 TTCCCCAACCTTTCTATGTGGGG + Intergenic
914904790 1:151735056-151735078 TTCAGCAACCCCTCTGTGTCAGG + Intergenic
914910092 1:151778213-151778235 TACCCCAAACTTTCTGTGTCTGG - Intronic
915902030 1:159854499-159854521 TCCCCCAAGCCTTCGGTCCCGGG + Exonic
917908537 1:179615028-179615050 TCCTCCCACCCCTCAGTGTCTGG + Intronic
920425995 1:205875598-205875620 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
920615657 1:207490432-207490454 TCCCCCATCCCTTCAGTCCCTGG + Intergenic
921269760 1:213457031-213457053 TTCTACAACCTTTCTGTGTCAGG - Intergenic
922685067 1:227632591-227632613 ACTCCCAACCCTTCTGGGTTGGG - Intronic
1063344419 10:5297858-5297880 TCCCCCTTCCTTTCTTTGTCAGG - Intergenic
1065199732 10:23301318-23301340 ACCCCCAACACTTCTGGGTTGGG - Intronic
1067232874 10:44424453-44424475 TCCCTCCACCCTTCAGTGCCAGG - Intergenic
1068060792 10:52064736-52064758 ACCCCCACCCCTTCTGAGTTGGG - Intronic
1068982895 10:63080060-63080082 TCCCCCACCCCGTCTCTGTATGG + Intergenic
1069841194 10:71340435-71340457 TCCCCCAACTCCTCTATGGCTGG + Intronic
1070325511 10:75386222-75386244 TCCCTCTACCCTTCTGTGGCTGG + Intergenic
1070566074 10:77604885-77604907 TCCCCCACCCCTTCCTTGTCAGG + Intronic
1070694243 10:78550246-78550268 GCCACCATCCCTTCTGTTTCTGG + Intergenic
1070818250 10:79338925-79338947 TCCCCTCAGCCTTCTGTGTCTGG + Intergenic
1071327318 10:84530097-84530119 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1072596971 10:96882315-96882337 TCCAACAACCTTTCTGTATCAGG - Intronic
1072620969 10:97078957-97078979 TGCCCCCACCATTGTGTGTCTGG - Intronic
1073350272 10:102814591-102814613 ACCCCCACCCCTTTTGAGTCGGG + Exonic
1074427031 10:113360454-113360476 TCCCCCAAATCTTGTGTGGCAGG - Intergenic
1075071227 10:119321142-119321164 TCTCCCAGCCCATCTGAGTCAGG + Intronic
1075572770 10:123557585-123557607 TCCCCCAACCCTGCTGTTCTGGG - Intergenic
1077030182 11:461997-462019 TCCACCTACCCTGCTGTGCCCGG - Intronic
1077299360 11:1840029-1840051 TGCCCCAAGCCTTCTGGGGCAGG + Intronic
1077839959 11:5963376-5963398 TCCCTCAGCCCTTATTTGTCTGG + Intergenic
1077889045 11:6405559-6405581 ACTCCCAGCCCTGCTGTGTCTGG - Intronic
1079601647 11:22317371-22317393 ACCCCCAACCCTTCTGAGTTGGG - Intergenic
1079865904 11:25733483-25733505 TCCTCCCACCCTCCTCTGTCAGG - Intergenic
1079934141 11:26596944-26596966 ACCCCCAACCCTTCTGTGTTGGG - Intronic
1080332039 11:31149941-31149963 TCCCGCAATCCTTCTGTGTCCGG - Intronic
1081371245 11:42306202-42306224 TCCCCAAACTTTTATGTGTCAGG + Intergenic
1083164335 11:60874407-60874429 TGCCCCTGCCCTTCTGTATCTGG + Intronic
1084234900 11:67781181-67781203 TCTTGCAACGCTTCTGTGTCTGG + Intergenic
1084732593 11:71082948-71082970 CCCCCCAACCCTTCTGAAACAGG + Intronic
1085294535 11:75423717-75423739 TCCCCCCACACATCTGTGCCTGG + Exonic
1086345553 11:85892144-85892166 TCCACCTTCCCTGCTGTGTCTGG - Intronic
1087902272 11:103654421-103654443 TCCCCCATCACTTGTGTGTGAGG + Intergenic
1088895387 11:114074502-114074524 TCCCCCAACCCATCTCTTTAAGG + Intronic
1089298765 11:117485298-117485320 CCCCTCAGCCCTTCTGTGTGTGG + Intronic
1089941025 11:122417937-122417959 TTCTCCCACCCTTCTGTCTCTGG + Intergenic
1092020435 12:5198041-5198063 TCCTCCCACCCTTCACTGTCAGG + Intergenic
1093039516 12:14362237-14362259 TCCCCCCACCCTATTTTGTCAGG - Intergenic
1093542161 12:20300115-20300137 TCCAACAACCTTGCTGTGTCTGG + Intergenic
1095138662 12:38637201-38637223 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1095283554 12:40384597-40384619 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1096352450 12:50911629-50911651 ACACCCAACCCTTCTGGGTTGGG - Intergenic
1097127672 12:56788412-56788434 CCCCCCAACCCTCCTGTCCCTGG + Intergenic
1098236709 12:68424625-68424647 TCCCCTAACCCTTCTGCCTCTGG - Intergenic
1098364246 12:69685843-69685865 TCCCCCCACATTTCTGTCTCAGG - Intronic
1098392351 12:69982943-69982965 TCCCTGAACCCCTCTGTGTAGGG + Intergenic
1098477260 12:70920186-70920208 TCCCTCACCCCTTCCCTGTCAGG + Intronic
1098565230 12:71927499-71927521 TCCCCCAACCTTTCTATCTAAGG - Intergenic
1101945454 12:109132805-109132827 TCCCCCAAACCTTCCTTGCCAGG - Intronic
1103802650 12:123549355-123549377 ACCCCCAACCCTTCTGTGTTGGG + Intergenic
1103875542 12:124124320-124124342 TCCCCAAACCCTGCTGGGTCGGG - Intronic
1104305927 12:127610984-127611006 GCCCCCAACTCTTCAGAGTCAGG + Intergenic
1104851875 12:131879993-131880015 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1106032903 13:26018604-26018626 TTGGCTAACCCTTCTGTGTCAGG - Intronic
1107578424 13:41753019-41753041 TCCCCCAACCCTTCAAGGTTTGG - Intronic
1108065474 13:46573020-46573042 TCCCCAAAGCCCTCTGTGACAGG - Intronic
1108462037 13:50676249-50676271 TCCACCAACCCTTTTATGACAGG - Intronic
1108876294 13:55054617-55054639 ACCCCCAACCCTTCTGGCTTGGG + Intergenic
1108936313 13:55885575-55885597 TCCACACACCCTTCTGTGTATGG - Intergenic
1112159471 13:96852942-96852964 TCTCCTAATCCTTCTGTGACTGG + Intergenic
1112182416 13:97096856-97096878 TCTCCCAGCCTTTCTGTGTTTGG - Intergenic
1112944434 13:104910019-104910041 TCCCCCAACTTTTGTTTGTCTGG + Intergenic
1114383947 14:22237327-22237349 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1114651509 14:24287716-24287738 TCGCCCATCCTTTATGTGTCTGG + Intergenic
1115177006 14:30574569-30574591 TCCTCCCACCCTCCTGCGTCAGG + Intronic
1119176209 14:72569317-72569339 TCCCCCTACCCCTCTGTTCCTGG + Intergenic
1119189516 14:72670957-72670979 TCCCCCCACCCCTCTGTTTTGGG - Exonic
1120759004 14:88269755-88269777 TTCGCCAAACCTTCTGTGTAAGG + Intronic
1121613039 14:95294138-95294160 TCCCCCACCCATTCTTTGGCAGG - Intronic
1121635876 14:95453599-95453621 TCCCACAAACCAACTGTGTCTGG - Intronic
1122454822 14:101842031-101842053 CCACCAAACCCTGCTGTGTCAGG + Intronic
1127799207 15:62463059-62463081 TCCCCCAACCCCCCTGCCTCTGG + Intronic
1128363005 15:66975908-66975930 CCCCCCAACCCTTCTGGGTTGGG - Intergenic
1130601873 15:85281126-85281148 TCCCCCATCCCATCAGTGTGGGG + Intergenic
1130731474 15:86497720-86497742 TCAAACAATCCTTCTGTGTCTGG + Intronic
1130767035 15:86881041-86881063 TCCCCCATCCCATCAGTGTGGGG - Intronic
1131420219 15:92298859-92298881 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
1131656127 15:94461009-94461031 CCCCCCAACCCATCAGTATCAGG - Intronic
1132980492 16:2736589-2736611 TCCCCCAACCTTGCTGTGAATGG - Intergenic
1133258666 16:4534461-4534483 TCCGCCACCCCTGCTGTTTCAGG + Intronic
1137767102 16:50986242-50986264 TCCCCCAGCCCTGCTGACTCTGG + Intergenic
1138099624 16:54242246-54242268 TCCCCCAGACATTCAGTGTCAGG + Intergenic
1138398725 16:56728943-56728965 TCCCCTCACCCTTCTGTGTGTGG + Intronic
1140790415 16:78385933-78385955 TCCCACTAGCCTTCTGTGTATGG - Intronic
1141173968 16:81707395-81707417 TCGCCCATCTCTTCTGTCTCAGG - Intronic
1141181594 16:81756586-81756608 TCCCCCACCACCTCTGTGCCTGG - Intronic
1141777909 16:86136535-86136557 TCACACAACCCTCCTGTGGCTGG - Intergenic
1141998162 16:87648065-87648087 TCCCCCAGCCCTGCTGTGACAGG + Intronic
1142182386 16:88677585-88677607 TCCCCAAATCCTGCTGTCTCAGG + Intergenic
1143289600 17:5818888-5818910 ACCCACATCCCTTCTGTGTTTGG - Intronic
1143779129 17:9220251-9220273 TCTCCCAACCCTTCTTTGATGGG - Intronic
1145013953 17:19384985-19385007 TCCTTCAACCCTTCTGGATCTGG - Intronic
1145058081 17:19716187-19716209 ACACCCACCCCTTCTGTGTGGGG + Intronic
1145886188 17:28384143-28384165 GCCCCCAACCCATCCGAGTCAGG + Intronic
1146016221 17:29235926-29235948 TCCCCCCACCCCTGTGTGACAGG + Intergenic
1146117211 17:30151619-30151641 TCCTCCACCTCTTCTGTCTCTGG - Intronic
1146920379 17:36706150-36706172 TCAGCCAACCCATCTCTGTCTGG + Intergenic
1146950228 17:36900369-36900391 TCCCCCAAACCTCCTGCCTCTGG + Intergenic
1147045978 17:37752513-37752535 TCCACTCACCCTACTGTGTCTGG + Intergenic
1149247471 17:54727746-54727768 TCCCCCAGCATTTCTTTGTCTGG + Intergenic
1149274461 17:55017784-55017806 ACTCCCAACCCTTCTGGGTTGGG - Intronic
1149330612 17:55577385-55577407 TCCCCGCACCATACTGTGTCAGG + Intergenic
1149439416 17:56662389-56662411 TCTCCCAAGCTTTCTGTGCCTGG + Intergenic
1149535030 17:57426878-57426900 TCCTCAAACACTTCTCTGTCAGG - Intronic
1152665526 17:81566665-81566687 TCCCCCGGCCTTTCTCTGTCAGG - Intronic
1157504025 18:48213297-48213319 TCCGCAAACCCTCCAGTGTCTGG + Intronic
1157564258 18:48668928-48668950 TCACCAAACACTTCTGTGCCCGG - Intronic
1159323203 18:66881710-66881732 TTCCCTTACCCTTCTGTGTATGG + Intergenic
1160034907 18:75291552-75291574 TTCCTCAACCCTGCTGTGCCTGG - Intergenic
1160605407 18:80046075-80046097 GCCTCCAACTCCTCTGTGTCCGG - Exonic
1160785141 19:896798-896820 TCCCCCACGCCACCTGTGTCGGG - Exonic
1161998221 19:7727654-7727676 TCCTCCAAGCCAACTGTGTCTGG + Intergenic
1162281756 19:9703640-9703662 TCTCTCAACCATTCTGTGTTGGG - Intergenic
1162961807 19:14132316-14132338 ACCCCCAACCCAGCTGTGTGAGG - Intronic
1163502663 19:17686182-17686204 TCCCCCAACGTCTCTGTTTCTGG + Intronic
1164056979 19:21630076-21630098 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1164838590 19:31375174-31375196 TCCCCCAGCTCTTTTCTGTCTGG + Intergenic
1165667057 19:37640836-37640858 TCCCCCACCCCTTTTTTTTCTGG + Intronic
1165926145 19:39327441-39327463 TCCCCCAACCTTGGTGTTTCCGG - Intergenic
1167395657 19:49226792-49226814 TCCTCCAACACTTCTGTCTCAGG - Intergenic
1167689067 19:50974760-50974782 TCCCCAGCCCCTTCTGTTTCTGG - Intergenic
1168303361 19:55419628-55419650 CCCCCCATCCCTTCAGTCTCAGG + Intergenic
1202646700 1_KI270706v1_random:148455-148477 TGCACCAACTCTTCTGTGTCTGG - Intergenic
926054685 2:9767735-9767757 CCCCCCAACTCTGCTGAGTCAGG + Intergenic
927221194 2:20711595-20711617 TCCCCTGACCCTTGTGTTTCTGG - Intronic
927518207 2:23684112-23684134 TCCCCCAACCTTTCAATTTCTGG + Intronic
928476119 2:31629568-31629590 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
928610290 2:32985874-32985896 TCCTTCACCCCTTCTGTATCTGG + Intronic
929229147 2:39541381-39541403 TCCCCCTACCCTGTTTTGTCAGG + Intergenic
932917277 2:75872649-75872671 ACTCCCAACCCTTCTGGGTTGGG + Intergenic
933175632 2:79169621-79169643 ACCCCCAACTCTTCTGGGTTGGG - Intergenic
933458664 2:82549999-82550021 TTCCCCACCCCTTATGTGTGGGG - Intergenic
934509857 2:94928873-94928895 TGCACCAACTCTTCTGTGTCGGG - Intergenic
935378240 2:102422255-102422277 TCCTCCAAGCTTTCTCTGTCTGG + Intronic
935748447 2:106209899-106209921 AACCCCAACCCTTCTGGGTTGGG + Intergenic
936087014 2:109476256-109476278 GCCCACAACCCCACTGTGTCTGG - Intronic
938949354 2:136242773-136242795 TCCCACAGCCCATCTGTGCCAGG - Intergenic
942136287 2:172929272-172929294 TCTACCAACAATTCTGTGTCAGG + Intronic
942580605 2:177412444-177412466 ACCCCCAAACCTTCTGGGTTGGG - Intronic
942830403 2:180232634-180232656 ACCCCCAACACTTCTGGGTTGGG + Intergenic
942961864 2:181839085-181839107 TACCACACCCATTCTGTGTCAGG - Intergenic
945095304 2:206213663-206213685 TCACCCAGCCCTCCTTTGTCTGG + Intronic
945200314 2:207274657-207274679 GCCCCCAACATTTCTGTGTCTGG - Intergenic
946173695 2:217910085-217910107 TGCCCCAACCCTCCTGGGTCTGG + Intronic
947495445 2:230632625-230632647 TGGCTCAACCCTTCTGTGCCTGG - Intergenic
948151203 2:235746469-235746491 TCCCTCCTCCCTTCTGTGTTAGG - Intronic
948801177 2:240434353-240434375 TTCCCTACCCCTTCTGTGCCTGG - Intergenic
1170756680 20:19212076-19212098 TCCTTCAACCCTTCTGTGCCAGG - Intergenic
1170984422 20:21244748-21244770 TCCCCCGACCTTCCTGTGTAAGG + Intronic
1171344821 20:24458172-24458194 TCCCCTTGCCCTTCTGTGTTAGG + Intergenic
1172123061 20:32609754-32609776 TCCCCTAATCCTTGTGTGGCTGG + Intergenic
1172998816 20:39091004-39091026 TCCCCCTCCCCTTCCTTGTCAGG + Intergenic
1173099120 20:40067335-40067357 TCCCTCAGCCTTTCTTTGTCTGG - Intergenic
1173103231 20:40107124-40107146 TCCCCCACATCTTATGTGTCTGG - Intergenic
1173725483 20:45294023-45294045 TCCCCCTGACCCTCTGTGTCCGG - Intronic
1173842268 20:46165630-46165652 TCCCTCAACACATCTGTGTCTGG - Intergenic
1174873104 20:54201611-54201633 CCCCCTAGCCCTTCTGTCTCTGG + Intergenic
1175380306 20:58558140-58558162 TCCCACAACCCCTCCGTGCCAGG - Intergenic
1176140139 20:63541396-63541418 TCACCCACCCCCTCTGGGTCAGG + Intronic
1176605166 21:8824309-8824331 TACACCAACTCTTCTGTGTCTGG + Intergenic
1177134818 21:17297550-17297572 ACCCCCAACTCTTCGGAGTCAGG + Intergenic
1177263882 21:18759593-18759615 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1177895827 21:26855375-26855397 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1178419430 21:32431669-32431691 TCTTGCAACGCTTCTGTGTCTGG - Intronic
1178961752 21:37072715-37072737 TCCGCCACCCCTTCTGTTGCGGG - Exonic
1180347459 22:11715914-11715936 TACACCAACTCTTCTGTGTCTGG + Intergenic
1180355224 22:11834022-11834044 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1180383027 22:12158305-12158327 TGCACCAACTCTTCTGTGTCGGG - Intergenic
1181310842 22:21943926-21943948 TGCACCAACCCTTCTGTCCCGGG + Intronic
1184059245 22:42072104-42072126 ATCCCCCACCTTTCTGTGTCGGG - Intergenic
1184732615 22:46378980-46379002 TCTCCCTTCCCTTCTGTGTCTGG + Intronic
1185250687 22:49800089-49800111 TCCCCCAACGCCTCTGTCCCCGG + Intronic
950720014 3:14875924-14875946 GCCCCCAAAGCCTCTGTGTCTGG - Intronic
951454277 3:22873202-22873224 TCCCCCAACCCCTCTCTCTAGGG + Intergenic
951526815 3:23661168-23661190 ACCCCCAACCCTTCCTTATCTGG - Intergenic
952826209 3:37527088-37527110 TCCCCTGACCTTTCTGTTTCAGG + Intronic
952922602 3:38296332-38296354 ACCCCCAACCCTTCTGGGTTGGG - Intronic
953722494 3:45368719-45368741 TCCCCCTACTCTACTGTCTCTGG - Intergenic
954751451 3:52816529-52816551 TCCCCCCAGCCTTCTGACTCTGG + Intronic
956710585 3:72035363-72035385 TCCCCCACACTTTCTGTCTCTGG + Intergenic
958016642 3:87945648-87945670 ACCCCCAGCCCTTCTGGGTTGGG - Intergenic
958630265 3:96674463-96674485 ACTCCCAACCCTTCTGGGTTGGG - Intergenic
960702453 3:120451248-120451270 TCCCCCTACCCCTTTGTGGCAGG - Exonic
960986569 3:123284837-123284859 TGCCCCTCTCCTTCTGTGTCAGG - Intronic
961439831 3:126946060-126946082 TGCCCCAACCCTGCTCTGTGTGG - Intronic
963915414 3:150854967-150854989 ATCCCCAACCCTTCTGAGTTGGG + Intergenic
964917277 3:161853093-161853115 ACCCCCGACCCTTCGGAGTCAGG - Intergenic
968391521 4:196748-196770 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
968732654 4:2277081-2277103 ACCCCTGAGCCTTCTGTGTCGGG - Intronic
969820253 4:9714572-9714594 TCTTGCAACGCTTCTGTGTCTGG - Intergenic
972781685 4:42291926-42291948 ACCCCCAACCCTTCCGGGTTGGG - Intergenic
973372939 4:49266595-49266617 TGCACCAACTCTTCTGTGTCGGG - Intergenic
973388059 4:49528464-49528486 TGCACCAACTCTTCTGTGTCAGG + Intergenic
976189382 4:82474222-82474244 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
977618338 4:99109231-99109253 AGCCCCAACCCTTCTGGGTTGGG - Intergenic
978218070 4:106231779-106231801 TCTCCCAACCCCTCTGTGTTAGG - Exonic
978909124 4:114045094-114045116 ACCCCCAATCCTTCTGGGTTGGG + Intergenic
979339868 4:119509784-119509806 TCCCTCAACACCTCAGTGTCGGG - Intronic
980443907 4:132882985-132883007 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
982081701 4:151796663-151796685 TCCGCCAAGCCTTCTGTCTCAGG - Intergenic
983285756 4:165736845-165736867 TTTCTCTACCCTTCTGTGTCTGG + Intergenic
983667341 4:170196377-170196399 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
990188553 5:53232700-53232722 ACCCCCAACTCTTCTGAGTCGGG - Intergenic
990891913 5:60659474-60659496 ACCCCCAACCCTTCTGGCTTGGG + Intronic
992167456 5:74068799-74068821 TCCTCCTCCCCTTCTGTGTTTGG + Intergenic
992466980 5:77015765-77015787 TCCCCCACACCTTCTATCTCAGG - Intergenic
994311692 5:98279754-98279776 CCCCCAAAACCATCTGTGTCTGG + Intergenic
995465262 5:112444648-112444670 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
995558276 5:113353283-113353305 CCCCCAGACCCTCCTGTGTCTGG - Intronic
996227797 5:121022601-121022623 TCCCCCAACCTTTATGGGGCAGG - Intergenic
998431381 5:142073289-142073311 TCCCCCATCCCTTCTCTATCAGG + Intergenic
999301938 5:150496654-150496676 TACCCCACCCCTTCTTTGGCAGG + Intronic
1001686030 5:173595727-173595749 TCCCCCACCCCTGCTGAGCCTGG - Intergenic
1002086707 5:176780480-176780502 CCCCCCAGCCCTTCTCTCTCTGG + Intergenic
1002410412 5:179070264-179070286 TCCCCCAACCCTCCTGTCTGTGG + Intronic
1003060538 6:2859043-2859065 TCCCCTGCCCCTTCTCTGTCTGG + Intergenic
1004236450 6:13879031-13879053 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1004644770 6:17549793-17549815 TCCCCCAACACTGATGTATCAGG - Intronic
1005324038 6:24682081-24682103 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1005364679 6:25064953-25064975 TCCCCTGACTCTACTGTGTCTGG - Intergenic
1006448631 6:34093213-34093235 ACCCCCAACCCTCCTGTCCCAGG - Intronic
1006565854 6:34956628-34956650 TCCCTCAACTTTTCTGTGTAGGG + Intronic
1007514227 6:42398633-42398655 TTCCCCAAACCTTCTGGGCCTGG + Intronic
1008706541 6:54167283-54167305 TGCCCCAATACTTCTGTGACTGG + Intronic
1009759466 6:67984946-67984968 TCCCCCAAACTTTCTTTGTAGGG - Intergenic
1011076484 6:83444454-83444476 ACCCCCAACCCTTCTGGGTGGGG + Intergenic
1011190234 6:84720200-84720222 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1011310553 6:85975368-85975390 CCCCCCGACCCTTCTGAGTCAGG - Intergenic
1012511077 6:100002597-100002619 TCCTGCAACCCTTCTGTGTTAGG + Intergenic
1012587820 6:100945518-100945540 TCCCTCAGCCCTGCTGTTTCCGG + Intergenic
1013021859 6:106228846-106228868 ACCCTCAACCCTTCTGGGTTGGG + Intronic
1013543174 6:111131668-111131690 GCCCCCAACCCTTCTGGGTTGGG + Intronic
1015789444 6:136951676-136951698 TCACTCAACCCTGCTGTGTAAGG - Intergenic
1016660410 6:146571302-146571324 TTCCCCATCTCTTCTCTGTCTGG - Intergenic
1017996262 6:159534142-159534164 TGCCCCAAGCCCTCTCTGTCTGG - Intergenic
1018126589 6:160689074-160689096 GCCCAAAACCCTTCTCTGTCTGG - Intergenic
1018186865 6:161273313-161273335 TCCCCCACCCCTCCTGTGATAGG + Intronic
1018379233 6:163242565-163242587 TCCCATCACCCTTCTGTGCCTGG - Intronic
1018760661 6:166891854-166891876 ACCCCCAACCCTTCTGGGTTGGG + Intronic
1019198924 6:170297832-170297854 ACACCCACCCCTTCTGTGTAAGG + Intronic
1019356047 7:579536-579558 TCCCCCAGCACCTCTGTGCCAGG + Intronic
1019698480 7:2460874-2460896 TCCCCCAATCCCTCCGTGACTGG + Intergenic
1019731970 7:2633508-2633530 TCCCTCCTCCCTGCTGTGTCTGG - Intronic
1021197107 7:17686064-17686086 TTCTCCAACCCCTCTATGTCAGG + Intergenic
1021385152 7:20020333-20020355 TTTCCCAACCCTTTTCTGTCAGG + Intergenic
1021979993 7:26044879-26044901 TCCCCCAAACCTTCTATCTTGGG - Intergenic
1023168950 7:37371890-37371912 TCCCCCAACCCATCTCTCCCTGG - Intronic
1023519751 7:41038536-41038558 TCTGCCAACTCTTCTGTGACCGG + Intergenic
1024105223 7:46077061-46077083 TGCCCCAATCCCTCTGTGCCTGG - Intergenic
1024659865 7:51483187-51483209 TCCCGCCACCCTGCTGAGTCTGG + Intergenic
1026788019 7:73313862-73313884 TCCCACAACACCTCTGTGTCAGG - Intronic
1028588989 7:92477201-92477223 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1029470005 7:100748354-100748376 ACGCCCATCCCTTCTGTGACTGG + Exonic
1030336919 7:108338026-108338048 ACCCCCAACCCTTCTGGGTTGGG + Intronic
1032725431 7:134586391-134586413 GCTCCCAACCCTTCTGGGTTGGG + Intergenic
1033653904 7:143361294-143361316 TGCCCCATTCCTGCTGTGTCCGG - Intronic
1034048533 7:147956722-147956744 TCCCCAAACCTATCTATGTCTGG - Intronic
1034248864 7:149672269-149672291 ACCCCCAACCCTTCTGGATTGGG + Intergenic
1034441642 7:151088633-151088655 TGCCCCCACCCTCCTGTGGCCGG - Intronic
1034886829 7:154804725-154804747 TCCCTCAGCCCTTAGGTGTCTGG + Intronic
1036009341 8:4703860-4703882 TCCCCCAACCCTGCTGTCCATGG - Intronic
1036591720 8:10174435-10174457 TCCCACAACCCTTCTGTCTTGGG + Intronic
1036782095 8:11656802-11656824 TGCCCCATCCTTTCTGTTTCTGG - Intergenic
1037329916 8:17734168-17734190 TCCCACAATCCCTCAGTGTCTGG + Intronic
1043400284 8:79877773-79877795 TCCCCCTACCCTTTTGCTTCTGG + Intergenic
1043508387 8:80925001-80925023 TCCCCCAACCCATAAGTCTCCGG - Intergenic
1043998263 8:86845314-86845336 TCCCTCAACTTTTCTTTGTCTGG - Intergenic
1047483056 8:125302691-125302713 CTCCCCAACCCCTCTGTCTCAGG - Intronic
1047700118 8:127441157-127441179 CCCCCCAACGCCTCTGAGTCAGG + Intergenic
1049093537 8:140534592-140534614 GCCCCCATTCCTTCTCTGTCAGG + Intronic
1049263095 8:141650288-141650310 TCCTAAAACCCTTCTGTCTCAGG - Intergenic
1049283609 8:141762911-141762933 TCTCCCCACCCTCCTGGGTCAGG + Intergenic
1050423901 9:5494295-5494317 CCTCCTGACCCTTCTGTGTCAGG - Intergenic
1050616055 9:7402774-7402796 TCCCCCACCTCTCCTGTCTCAGG - Intergenic
1051230509 9:14950250-14950272 TCCCCCAAGTGTTCTGTCTCAGG - Intergenic
1053280837 9:36819056-36819078 CCCACCAGCCTTTCTGTGTCTGG + Intergenic
1053305307 9:36980596-36980618 TCCCCCAACCCTTCTGTGTCTGG - Intronic
1053655540 9:40215379-40215401 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1053905911 9:42844597-42844619 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1054351942 9:64025409-64025431 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1054367659 9:64361610-64361632 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1054529063 9:66160912-66160934 TGCACCAACTCTTCTGTGTCGGG - Intergenic
1054675278 9:67851346-67851368 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1056473324 9:86927096-86927118 TCACCCCAGTCTTCTGTGTCTGG + Intergenic
1057920411 9:99092474-99092496 TCCCCCAGCCCTTCTACGTAGGG - Intergenic
1059337827 9:113580261-113580283 TCCCCAAACACTTGTGTGTAAGG + Intronic
1059985297 9:119815137-119815159 CCCCCCAACCCTACTGGGTTGGG - Intergenic
1060899249 9:127243057-127243079 TTTCCCAACTCTTCTGTTTCAGG + Intronic
1061909576 9:133715621-133715643 GGCCACAGCCCTTCTGTGTCGGG + Intronic
1062048703 9:134436351-134436373 TACCCCAACCCCTCTGAGGCTGG - Intronic
1062308671 9:135923748-135923770 CGCCCCAGCCCTTCTGGGTCAGG + Intergenic
1062353096 9:136148655-136148677 TCCCCCACCCCTTCCCTGGCTGG - Intergenic
1062715839 9:138009718-138009740 TCCCCCAACCCAGCTCTTTCGGG - Intronic
1203552566 Un_KI270743v1:176408-176430 TGCACCAACTCTTCTGTGTCGGG + Intergenic
1185597537 X:1316830-1316852 GCCCTCAACGCCTCTGTGTCTGG - Intergenic
1186254434 X:7703330-7703352 ACCCCCAACCCTTGTGGGTTGGG - Intergenic
1186307328 X:8276514-8276536 TCCCCAAACCCTTCTATCTAGGG - Intergenic
1188058512 X:25570831-25570853 TCCCCCAAGTCTTCAGTCTCTGG + Intergenic
1188999918 X:36933096-36933118 TCACCCAACCCTTGAGGGTCAGG + Intergenic
1191103016 X:56753286-56753308 TCCAAGAAGCCTTCTGTGTCTGG - Intergenic
1191167397 X:57404988-57405010 ACCCCCAACCCTTCTGTGTTGGG - Intronic
1192940280 X:75904352-75904374 AACCCCAACCCTTCTGGGTTGGG - Intergenic
1192992161 X:76471766-76471788 TCCCCCAAGTGTTCTGTCTCAGG - Intergenic
1193172287 X:78349797-78349819 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1193306342 X:79956631-79956653 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1195584699 X:106551952-106551974 ACCCCCAACCCTTCTGGGTTAGG + Intergenic
1198656074 X:138914470-138914492 TACCCCAACCCTGCTGTCTGGGG - Intronic
1199795694 X:151193552-151193574 TCCCTCAGCCTTTGTGTGTCTGG - Intergenic
1199861913 X:151808657-151808679 TCCTCCAACCCTTCCGTCACTGG - Intergenic
1201153830 Y:11111981-11112003 TGCACCAACTCTTCTCTGTCGGG + Intergenic