ID: 1053305314 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:36980646-36980668 |
Sequence | CAGTGTAGAGACCCTGTTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053305307_1053305314 | 27 | Left | 1053305307 | 9:36980596-36980618 | CCAGACACAGAAGGGTTGGGGGA | 0: 1 1: 0 2: 5 3: 68 4: 262 |
||
Right | 1053305314 | 9:36980646-36980668 | CAGTGTAGAGACCCTGTTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053305314 | Original CRISPR | CAGTGTAGAGACCCTGTTGG AGG | Intronic | ||
No off target data available for this crispr |