ID: 1053305314

View in Genome Browser
Species Human (GRCh38)
Location 9:36980646-36980668
Sequence CAGTGTAGAGACCCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053305307_1053305314 27 Left 1053305307 9:36980596-36980618 CCAGACACAGAAGGGTTGGGGGA 0: 1
1: 0
2: 5
3: 68
4: 262
Right 1053305314 9:36980646-36980668 CAGTGTAGAGACCCTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053305314 Original CRISPR CAGTGTAGAGACCCTGTTGG AGG Intronic
No off target data available for this crispr