ID: 1053306241

View in Genome Browser
Species Human (GRCh38)
Location 9:36986487-36986509
Sequence AGCGGGCGGCCTCCTTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053306230_1053306241 20 Left 1053306230 9:36986444-36986466 CCAATGTCAATTAAATTGCAAAT 0: 1
1: 0
2: 3
3: 33
4: 372
Right 1053306241 9:36986487-36986509 AGCGGGCGGCCTCCTTCCCGGGG No data
1053306229_1053306241 23 Left 1053306229 9:36986441-36986463 CCGCCAATGTCAATTAAATTGCA 0: 1
1: 1
2: 1
3: 17
4: 180
Right 1053306241 9:36986487-36986509 AGCGGGCGGCCTCCTTCCCGGGG No data
1053306228_1053306241 27 Left 1053306228 9:36986437-36986459 CCTGCCGCCAATGTCAATTAAAT 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1053306241 9:36986487-36986509 AGCGGGCGGCCTCCTTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053306241 Original CRISPR AGCGGGCGGCCTCCTTCCCG GGG Intronic
No off target data available for this crispr