ID: 1053306363

View in Genome Browser
Species Human (GRCh38)
Location 9:36986947-36986969
Sequence CTGGGTGTCCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053306351_1053306363 -1 Left 1053306351 9:36986925-36986947 CCGTCCAGCCCATGCCCAGTGCC 0: 1
1: 0
2: 6
3: 45
4: 483
Right 1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG No data
1053306349_1053306363 7 Left 1053306349 9:36986917-36986939 CCGGGGTCCCGTCCAGCCCATGC 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG No data
1053306355_1053306363 -9 Left 1053306355 9:36986933-36986955 CCCATGCCCAGTGCCTGGGTGTC 0: 1
1: 0
2: 4
3: 25
4: 244
Right 1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG No data
1053306353_1053306363 -5 Left 1053306353 9:36986929-36986951 CCAGCCCATGCCCAGTGCCTGGG 0: 1
1: 0
2: 6
3: 63
4: 625
Right 1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG No data
1053306356_1053306363 -10 Left 1053306356 9:36986934-36986956 CCATGCCCAGTGCCTGGGTGTCC 0: 1
1: 0
2: 6
3: 34
4: 402
Right 1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG No data
1053306350_1053306363 0 Left 1053306350 9:36986924-36986946 CCCGTCCAGCCCATGCCCAGTGC 0: 1
1: 0
2: 4
3: 32
4: 305
Right 1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053306363 Original CRISPR CTGGGTGTCCAGAGGGAGGA AGG Intronic
No off target data available for this crispr