ID: 1053306928

View in Genome Browser
Species Human (GRCh38)
Location 9:36991264-36991286
Sequence GTGACCTACCCAAGGTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053306926_1053306928 -8 Left 1053306926 9:36991249-36991271 CCACAGATGTGAGAAGTGACCTA 0: 1
1: 0
2: 0
3: 7
4: 145
Right 1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053306928 Original CRISPR GTGACCTACCCAAGGTCACA TGG Intronic
No off target data available for this crispr