ID: 1053307071

View in Genome Browser
Species Human (GRCh38)
Location 9:36992309-36992331
Sequence AACCTAGCAATGCTATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 604}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053307071_1053307079 20 Left 1053307071 9:36992309-36992331 CCAATCAATAGCATTGCTAGGTT 0: 1
1: 0
2: 3
3: 41
4: 604
Right 1053307079 9:36992352-36992374 CCCCAGATGGGGTCTCCAGGTGG No data
1053307071_1053307074 7 Left 1053307071 9:36992309-36992331 CCAATCAATAGCATTGCTAGGTT 0: 1
1: 0
2: 3
3: 41
4: 604
Right 1053307074 9:36992339-36992361 CATCAAAAATATGCCCCAGATGG No data
1053307071_1053307082 27 Left 1053307071 9:36992309-36992331 CCAATCAATAGCATTGCTAGGTT 0: 1
1: 0
2: 3
3: 41
4: 604
Right 1053307082 9:36992359-36992381 TGGGGTCTCCAGGTGGCTGCAGG No data
1053307071_1053307076 9 Left 1053307071 9:36992309-36992331 CCAATCAATAGCATTGCTAGGTT 0: 1
1: 0
2: 3
3: 41
4: 604
Right 1053307076 9:36992341-36992363 TCAAAAATATGCCCCAGATGGGG No data
1053307071_1053307075 8 Left 1053307071 9:36992309-36992331 CCAATCAATAGCATTGCTAGGTT 0: 1
1: 0
2: 3
3: 41
4: 604
Right 1053307075 9:36992340-36992362 ATCAAAAATATGCCCCAGATGGG No data
1053307071_1053307077 17 Left 1053307071 9:36992309-36992331 CCAATCAATAGCATTGCTAGGTT 0: 1
1: 0
2: 3
3: 41
4: 604
Right 1053307077 9:36992349-36992371 ATGCCCCAGATGGGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053307071 Original CRISPR AACCTAGCAATGCTATTGAT TGG (reversed) Intronic
901250491 1:7774918-7774940 GACCTAGCAATGCTACTCCTAGG - Intronic
903890371 1:26566079-26566101 TACCTAGCAATGGAATTGCTGGG + Intronic
905802893 1:40856737-40856759 TACCTAGCAGTGCTATTTACAGG + Intergenic
906379100 1:45320384-45320406 AACCTTTCACTGCTATTCATGGG - Intergenic
906441512 1:45849964-45849986 AACCCAGCAATCCTATTACTGGG - Intronic
906606617 1:47177091-47177113 GACCTAGCAATCCCATTGCTGGG + Intergenic
906882967 1:49612859-49612881 GACCTAGCAATCCCATTGCTGGG + Intronic
906997728 1:50815562-50815584 TACCCAGCAATGCTATTACTAGG - Intronic
907253213 1:53157420-53157442 AACCTAGCAATGGGACTCATAGG - Intergenic
907624894 1:56020647-56020669 AACCTGGCAATGTTCTTGAAAGG + Intergenic
907748353 1:57237667-57237689 AAACTTACAAGGCTATTGATGGG - Intronic
907960062 1:59270653-59270675 AACCTAGCAATCCTATTACTTGG - Intergenic
907994885 1:59620034-59620056 AATGTAGCATTGCTATTAATGGG + Intronic
908105770 1:60840467-60840489 AACCCAGCAATACTATTACTGGG + Intergenic
908396990 1:63734684-63734706 GACCCAGCAATCCTATTGCTAGG - Intergenic
909048582 1:70740525-70740547 CACCTAGCAATCCTATTACTGGG - Intergenic
909252726 1:73379562-73379584 GACCCAGCAATCCTATTGCTGGG - Intergenic
909414704 1:75392630-75392652 AACCTAGCAATCCCATTGCTTGG + Intronic
909705255 1:78574438-78574460 AAACTAGAAATGGAATTGATGGG + Intergenic
909730125 1:78879363-78879385 AACCTTTCACTGCTATTTATGGG - Intergenic
910544805 1:88402629-88402651 AACATATCCATGCTATTGTTTGG + Intergenic
910632962 1:89375485-89375507 AACCTAGCAATCCCATTACTGGG + Intronic
910788459 1:91025600-91025622 AACCCAGCAATCCTATTGCTAGG - Intergenic
911036627 1:93557093-93557115 AACCTAGCAATTCTACTCCTCGG - Intergenic
911202798 1:95062812-95062834 GACCTAGCAATCCCATTGCTGGG - Intronic
911443289 1:97957478-97957500 AACCTAACTATGCTGTTTATTGG + Intergenic
911901382 1:103510234-103510256 GACCTAGCAATCCCATTGCTGGG - Intergenic
912326113 1:108764407-108764429 TACCTAGTAATGCGATTGCTGGG + Intronic
912344341 1:108950988-108951010 TACCTAGCAATGGAATTGCTGGG - Intronic
915771283 1:158427528-158427550 AACCCAGCAATCCCATTGCTGGG - Intergenic
916339718 1:163718325-163718347 TACCTAGCAATGGGATTGCTTGG - Intergenic
916386608 1:164280049-164280071 TACCCAGTAATGCTATTGCTAGG - Intergenic
916907335 1:169301549-169301571 AACCTAGCAATTCCATTACTGGG + Intronic
916927160 1:169534333-169534355 GACCTAGCAATTCTATTACTGGG + Intronic
917394756 1:174581148-174581170 GACCCAGCAATTCTATTTATAGG + Intronic
917689531 1:177453683-177453705 AACCCAGCAATCCTATTACTGGG - Intergenic
917886191 1:179387536-179387558 AACCTAGCAGTAATTTTGATTGG + Intronic
918155637 1:181843559-181843581 AACCTAGCAATCCCATTATTGGG - Intergenic
918196233 1:182224840-182224862 GACCTAGCAATCCTATTACTGGG + Intergenic
918788121 1:188790810-188790832 AACCTAGCAATCCCATTACTGGG + Intergenic
918877123 1:190062162-190062184 AACTTAGCAATGCCATTACTGGG - Intergenic
919400602 1:197111989-197112011 AACCCAGCAATCCCATTAATGGG + Intronic
919742547 1:200989625-200989647 AGCCTAGCACTGCTTTGGATAGG + Intronic
921125164 1:212171226-212171248 AACCTAGCAATCCCACTGCTGGG - Intergenic
921662816 1:217827510-217827532 AACCCAGCAATCCCATTGCTGGG + Intronic
921767291 1:218987183-218987205 TACCTAGCAATGGGATTGCTGGG + Intergenic
921797003 1:219357674-219357696 AATCTAGCAATCATATTGGTAGG + Intergenic
921933617 1:220776040-220776062 AACCTAGCAATCCCATTACTGGG - Intronic
921987288 1:221326141-221326163 AACCCAGCAATCCTATTACTGGG - Intergenic
922273333 1:224054646-224054668 AACTTAAAAATGCTACTGATAGG - Intergenic
923420296 1:233808144-233808166 TACCTACCAATGCTCTTAATGGG - Intergenic
923833427 1:237582941-237582963 AACCTAGCAATCCCATTACTGGG - Intronic
923855883 1:237845091-237845113 GACCCAGCAATGCTATTACTGGG + Intergenic
924011086 1:239666029-239666051 AACCCAGCAATGGGATTGCTGGG + Intronic
924414187 1:243841655-243841677 AACTTAGGAATGATATTGCTGGG - Intronic
924769975 1:247071096-247071118 AACCCAGCAATCCTATTACTGGG + Intronic
1063343329 10:5289244-5289266 AACCTAGCAATCCCATTAGTGGG + Intergenic
1063736745 10:8765401-8765423 GACCTAGCAATTCTATTCAAAGG + Intergenic
1063774838 10:9251093-9251115 AACCCAGCAATCCCATTGCTGGG + Intergenic
1064564200 10:16623540-16623562 AACCCAGCAATCCCATTGGTGGG - Intronic
1064779963 10:18824362-18824384 TACCTAGTAATGCGATTGCTGGG + Intergenic
1064880770 10:20050862-20050884 AACCCAGCAATCCTATTACTGGG + Intronic
1064917254 10:20473717-20473739 AACCTACCAATCCTATTACTGGG + Intergenic
1065118764 10:22507836-22507858 GACATAGCAATGCCTTTGATAGG - Intergenic
1065739955 10:28788227-28788249 TACCTAGTAATGGGATTGATGGG + Intergenic
1066519247 10:36197284-36197306 GACCTAGCAATGCCATTATTGGG + Intergenic
1067317521 10:45181895-45181917 TACCTAGCAATGGGATTGCTGGG - Intergenic
1068249338 10:54416636-54416658 TACCTAGTAATGATATTGTTGGG + Intronic
1069146489 10:64897657-64897679 GATCTAGCAATGCTACTGCTAGG - Intergenic
1069543707 10:69314409-69314431 AACCTAGCATTTCTATTAGTTGG - Intronic
1070054005 10:72916691-72916713 GACCTAGCAATGCCATTACTGGG - Intronic
1070061424 10:72987087-72987109 AACCTAGGAATGGAATTCATGGG + Intergenic
1070401990 10:76060999-76061021 GACCTAGCAATCCTATTACTGGG + Intronic
1070709745 10:78672013-78672035 GACCTAGCAATCCCATTGCTGGG + Intergenic
1070822427 10:79368135-79368157 TACCTAGGAATGGTATTGCTGGG - Intergenic
1071408849 10:85366519-85366541 AACCTAGCAATCCTATTACTAGG - Intergenic
1071825869 10:89325343-89325365 AACCCAGCAATCCTATTATTGGG + Intronic
1072029953 10:91509434-91509456 AACCCAGCAATGCCATTATTGGG + Intronic
1072247226 10:93554513-93554535 AATATAGCAATGCTATTGTGGGG - Intergenic
1073948357 10:108778440-108778462 AACCTAGCAATCCCATTACTGGG - Intergenic
1073953941 10:108845668-108845690 AACCTAGCAATCCCATTACTGGG + Intergenic
1073984718 10:109194890-109194912 GACCCAGCAATCCTATTGCTGGG - Intergenic
1075135811 10:119785220-119785242 TACCTAGCAATGGAATTGCTGGG + Intronic
1075156691 10:119983231-119983253 AACCTAGCAATTCCATTACTGGG - Intergenic
1075488056 10:122843086-122843108 AACCCAGCAATTCTATTGCTAGG + Intronic
1077396153 11:2323463-2323485 TACCTAGCAATGGGATTGCTGGG - Intergenic
1078429066 11:11273670-11273692 AATCTAGCAATCCCATTGTTGGG + Intronic
1078472385 11:11601894-11601916 AACACAGTAATGCTGTTGATAGG - Intronic
1078525435 11:12097394-12097416 AACCTAGCATTGCATTTCATTGG + Intronic
1078797288 11:14605067-14605089 AACCTAGCAATCCCATTACTAGG - Intronic
1078960989 11:16270479-16270501 AACCTAGGAATGGAATTGCTGGG - Intronic
1079636350 11:22746339-22746361 TACCTAGTAACGCGATTGATGGG - Intronic
1079729801 11:23925848-23925870 GACCCAGGAATGCTATTGCTGGG + Intergenic
1079798253 11:24834605-24834627 TACCCAGCAATGGTATTGCTGGG + Intronic
1080167480 11:29256600-29256622 AACCCAGCAATGCCATTACTGGG - Intergenic
1080173446 11:29334068-29334090 AACCAACCACTGCTATTTATAGG + Intergenic
1080827970 11:35863838-35863860 AACCCAGCAATCCCATTGGTGGG - Intergenic
1081117901 11:39228120-39228142 AAGCTACCGATGCTATTGACAGG - Intergenic
1081133383 11:39407810-39407832 AACCTAGCAATCCCATTACTGGG + Intergenic
1081322579 11:41709191-41709213 AACCTAGCAAAGCTACTGCTTGG + Intergenic
1082208446 11:49467784-49467806 AACCTAGCAATCCCATTACTAGG + Intergenic
1082957842 11:58890297-58890319 AACCCAGCAATGCCATTACTAGG + Intronic
1083362411 11:62119948-62119970 AACCCAGCAATGCCATTGCTGGG - Intergenic
1085424820 11:76394704-76394726 AATCTAGCAATCCCATTGTTAGG - Intronic
1086008084 11:82064173-82064195 AACCCAGCAATCCTATTATTGGG - Intergenic
1086641172 11:89157726-89157748 AACCTAGCAATCCCATTACTAGG - Intergenic
1086660739 11:89413306-89413328 GACCCAGCAATCCTATTGGTAGG + Intronic
1087570660 11:99923588-99923610 AACCTAGCAATCCCATTACTGGG - Intronic
1087596649 11:100262418-100262440 AACCCAGCAATCCTATTACTGGG + Intronic
1088809304 11:113379655-113379677 AACCCAGCAATCCTATTACTAGG - Intronic
1089872358 11:121686849-121686871 AACCTAGCAATCCCATTACTGGG - Intergenic
1089951103 11:122527311-122527333 AACTTAGCAATCCCATTAATGGG - Intergenic
1089955345 11:122565986-122566008 AACCCAGCAATCCCATTAATGGG + Intergenic
1090540878 11:127702500-127702522 AACCTACCAATGGTATTGCTAGG + Intergenic
1090540879 11:127702502-127702524 TACCTAGCAATACCATTGGTAGG - Intergenic
1092722385 12:11454565-11454587 AACCTAGCAATCCCATTGCTGGG + Intronic
1093248257 12:16767517-16767539 TACCTAGCAATGAGATTGCTGGG - Intergenic
1093311734 12:17596322-17596344 CACCTAGCAGTGCAATTGTTGGG + Intergenic
1094128856 12:27053119-27053141 GACCCAGCAATCCCATTGATGGG - Intronic
1094817093 12:34198723-34198745 TACCCAGCAATGATATTGCTGGG - Intergenic
1095119859 12:38404414-38404436 TACCTAGCAATGGGATTGCTGGG + Intergenic
1095119860 12:38404416-38404438 AACCCAGCAATCCCATTGCTAGG - Intergenic
1095850918 12:46804541-46804563 AATCTAGCATTGCTTCTGATTGG - Intronic
1096005785 12:48170187-48170209 AACCCAGCAATGATATTTTTGGG + Intronic
1096905521 12:54932008-54932030 AACCTTTCACTGCTATTCATGGG + Intergenic
1098302957 12:69072864-69072886 GACCTAGCAATGCTACTTCTGGG - Intergenic
1098327513 12:69317649-69317671 AACCTAGCAATGCAATTATTGGG - Intergenic
1098519075 12:71415128-71415150 TACCTAGGAATGCAATTGCTGGG - Intronic
1099271629 12:80517996-80518018 AATCTAGCAATCCTACTGCTGGG - Intronic
1099696718 12:86032273-86032295 AACCCAGCAATCCTATTATTTGG - Intronic
1099886454 12:88537107-88537129 AACCCAGCAATCCCATTGCTGGG + Intronic
1100424320 12:94469148-94469170 AATCTAGCAATTCCATTTATGGG + Intergenic
1100500276 12:95167251-95167273 GACCTAGCAATGCTACTCTTAGG - Intronic
1100931328 12:99613331-99613353 AACCCAGCAATCCCATTGCTGGG + Intronic
1100950514 12:99843769-99843791 AACCCAGCAATCCTATTACTGGG - Intronic
1101046139 12:100808078-100808100 AACCCAGCAATCCTATTACTGGG - Intronic
1101443276 12:104719361-104719383 CACCTAGAAATCCAATTGATGGG - Intronic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1102605046 12:114061850-114061872 AACCTTTCACTGCTATTCATGGG - Intergenic
1102668182 12:114594528-114594550 GACCCAGCAATGCTATTACTGGG + Intergenic
1104258003 12:127156628-127156650 AACCTTTCATTGCTATTCATGGG - Intergenic
1104305338 12:127605415-127605437 TACCTAGCAATGAAATTGCTGGG + Intergenic
1104524781 12:129509983-129510005 GACCCAGCAATCCTATTGCTCGG - Intronic
1105648106 13:22343105-22343127 GACCTAGCAATCCTATTACTGGG + Intergenic
1105735507 13:23265891-23265913 AACCTAGCAATCCCACTGCTGGG + Intronic
1105763521 13:23534890-23534912 AACCTAGGAATGGCATTGCTGGG + Intergenic
1106202039 13:27546630-27546652 AACTTAGCAATTGTATTGCTGGG - Exonic
1106476634 13:30104447-30104469 GACCCAGCAATTCTACTGATGGG - Intergenic
1106640561 13:31580284-31580306 AACATATCCATGCTATGGATAGG - Intergenic
1106732396 13:32555008-32555030 GACCTAGCAATTCTATTACTGGG + Intergenic
1106805941 13:33307286-33307308 AACCTAGTAATGGGATTGCTCGG - Intronic
1107151973 13:37122039-37122061 AACCCAGCAATCCTATTATTGGG - Intergenic
1107675469 13:42792213-42792235 CATCTAGCAATGCTACTGCTGGG - Intergenic
1107855047 13:44606739-44606761 TACCTAGTAATGCGATTGCTGGG + Intergenic
1108841188 13:54617425-54617447 AACCTAGCAATTCCATTCCTAGG - Intergenic
1108952413 13:56111885-56111907 AACCCAGCAATCCTACTGCTAGG - Intergenic
1109086950 13:57986082-57986104 AACCTAGCAATCCCATTACTGGG + Intergenic
1109407705 13:61922626-61922648 AACCCAGCAATCCCATTGCTTGG - Intergenic
1109573320 13:64221094-64221116 AGCCTAGCAATCCTATTACTGGG - Intergenic
1109645813 13:65253414-65253436 AACCCAGCAATCCCATTAATGGG - Intergenic
1109915530 13:68980731-68980753 TACCCAGCAATGATATTGCTGGG - Intergenic
1109931995 13:69227759-69227781 AGCCAAGGAATGCTATGGATTGG + Intergenic
1110012182 13:70350597-70350619 AACCCAGCAATCCTATTACTGGG - Intergenic
1111050062 13:82871186-82871208 AACCCAGCAATGCTATTATTGGG - Intergenic
1111089602 13:83426404-83426426 AACTCAGCAATGCCATTGCTGGG - Intergenic
1111697233 13:91640608-91640630 AACCTAGTAATGGGATTGCTGGG - Intronic
1112547051 13:100381434-100381456 AACCTTCAAATGCTATTGGTGGG + Intronic
1112832957 13:103476421-103476443 AAACTGGGAATGCTATTGAGAGG + Intergenic
1113095834 13:106663005-106663027 AACCCAGGACTGCTATTGACGGG - Intergenic
1114032983 14:18591949-18591971 GACCCAGCAATGCCATTGGTAGG + Intergenic
1114077779 14:19171146-19171168 GACCCAGCAATGCCATTGGTAGG + Intergenic
1114125954 14:19725809-19725831 GACCCAGCAATGCCATTGTTAGG - Intronic
1114770730 14:25427030-25427052 AACCTTTCACTGCTATTCATGGG + Intergenic
1115009829 14:28532172-28532194 TACCTAGCAATGAGATTGCTGGG + Intergenic
1115032516 14:28814120-28814142 AACCTAGCAATCCTATTACTAGG + Intergenic
1115128780 14:30027625-30027647 AACCTAGCAATCCCATTACTGGG - Intronic
1115883684 14:37947865-37947887 AACCTAGCAATCCCATTATTGGG + Intronic
1116073735 14:40083808-40083830 AACCCAGCAATCCTATTACTGGG + Intergenic
1116327582 14:43550909-43550931 AACCTAGCAATTCTACTCCTAGG + Intergenic
1116445835 14:45009870-45009892 AACCTAGTAATAGAATTGATAGG + Intronic
1116913850 14:50501590-50501612 AACCTAGAAAGGATAATGATAGG + Intronic
1117180638 14:53187606-53187628 AACAAAGCAATGCCATTGAAAGG + Intergenic
1117691096 14:58307148-58307170 AAACCAACAATGCTATAGATTGG - Intronic
1118041527 14:61922160-61922182 CACCTAGCAATCCTATTACTGGG + Intergenic
1118651821 14:67904267-67904289 AACCTAGCAATCCTACTACTAGG - Intronic
1118801786 14:69196503-69196525 AACCTAGCAATGCCACTGGCAGG - Intronic
1119369437 14:74126362-74126384 AACCTAGCAATGGAATTGCTGGG - Intronic
1119417650 14:74484666-74484688 ACCCTAGGAATGCTGTTGCTTGG - Intronic
1119981631 14:79088052-79088074 AACCTAGCATTGTTCTTGAAGGG - Intronic
1120021369 14:79534633-79534655 AACCTTGCCATGTTTTTGATTGG - Intronic
1120239275 14:81930975-81930997 AACCTAGCAAATCTATCTATGGG - Intergenic
1120769929 14:88367920-88367942 TACCTAGTAATGATATTGCTGGG + Intergenic
1122705819 14:103620607-103620629 AACCTAGGAATGAAATTGCTGGG - Intronic
1123569186 15:21585111-21585133 GACCCAGCAATGCCATTGGTAGG - Intergenic
1123605296 15:22020431-22020453 GACCCAGCAATGCCATTGGTAGG - Intergenic
1123671840 15:22666331-22666353 ATCCTAGCAATGCTAGCAATTGG - Intergenic
1124855513 15:33383742-33383764 TACCTAGCAATGGGATTGCTGGG - Intronic
1125111845 15:36043421-36043443 AACCCAGCAATCCCATTGCTGGG + Intergenic
1125138789 15:36377956-36377978 AACCTAGCAGTGGGATTGCTGGG + Intergenic
1125621349 15:41065501-41065523 GACCTAGCAATTCTACTCATAGG + Intronic
1125794021 15:42391329-42391351 AACCCAGCAATTCTACTGCTGGG - Intronic
1126213257 15:46124905-46124927 AACCCAGCAATCCTATTATTGGG + Intergenic
1126463950 15:48943614-48943636 GACCCAGCAATCCTATTGCTGGG - Intronic
1126880180 15:53085847-53085869 GACCTAGCAATCCCATTAATGGG - Intergenic
1127510977 15:59640968-59640990 AACCTAGCAGCGTTATTGTTGGG - Intronic
1127574448 15:60276933-60276955 TACCTAGTAATGAGATTGATGGG - Intergenic
1127708991 15:61576599-61576621 AACCTAGCAATCCTATTACTGGG + Intergenic
1127745266 15:61963553-61963575 AATGTAGGAATGCTATTGATGGG - Intronic
1128172739 15:65527296-65527318 AACCTAGCAATTCCCTTCATAGG + Intergenic
1129588989 15:76898374-76898396 AACCCAGCAATTCTATTCCTAGG + Intronic
1129764181 15:78150543-78150565 ATCCTAGCAATGCCACTGATTGG + Intronic
1129959527 15:79670863-79670885 AACCCAGCAATCCCATTGCTGGG + Intergenic
1129971918 15:79786257-79786279 AACCCAGCAATCCCATTGCTGGG + Intergenic
1130154773 15:81340736-81340758 TACCTAGGAATGCAATTGCTGGG - Intronic
1130366544 15:83245120-83245142 AACCCAGCAATCCTATTACTGGG - Intergenic
1130674600 15:85940578-85940600 AACCTAGCAAAGCTGTTGGCTGG - Intergenic
1130730697 15:86488885-86488907 CACCAAGCATTGCTCTTGATAGG + Intronic
1131598022 15:93818803-93818825 AACCCAGCAATCCCATTGCTGGG + Intergenic
1131608943 15:93940567-93940589 AACCCAGCAATCCTATTACTGGG + Intergenic
1131959931 15:97779146-97779168 AACTTAGCAATGCCATTACTGGG + Intergenic
1132144683 15:99422140-99422162 AACCCAGCAATCCTATTTCTGGG - Intergenic
1132260798 15:100423246-100423268 AACCCAGCAATCCTATTACTGGG + Intronic
1202977539 15_KI270727v1_random:312201-312223 GACCCAGCAATGCCATTGGTAGG - Intergenic
1133383759 16:5352331-5352353 TACCTAGGAATGCAATTGCTGGG - Intergenic
1133621263 16:7528874-7528896 AACCTTGCAATGCTAGAGCTGGG + Intronic
1134115509 16:11544883-11544905 TACCTAGGAATGCAATTGCTGGG - Intergenic
1137356140 16:47766512-47766534 AACCCAGCAATCCTATTACTGGG - Intergenic
1137447688 16:48541879-48541901 AAGCTACTAATGCTATTTATTGG + Exonic
1139196748 16:64928373-64928395 GACCTAGCAATTCCATTAATAGG + Intergenic
1139554887 16:67701230-67701252 AACCTAGCAATCCTACTTCTAGG + Intronic
1140605720 16:76534473-76534495 AACCTGGCAATTCTATTGAGAGG - Intronic
1140949603 16:79803877-79803899 AACCCAGCAATTCTATTCATAGG - Intergenic
1141080912 16:81051667-81051689 AACCTAGCAATCCCATTAGTGGG + Intergenic
1141315132 16:82955128-82955150 AACCTAGCAATTCTAATCCTAGG - Intronic
1143070674 17:4290412-4290434 AAGAGAGCAATGATATTGATTGG - Intronic
1143348495 17:6268488-6268510 AACCTAGCAATCTTATTACTGGG - Intergenic
1144335338 17:14263848-14263870 AATCCAGCAATTCTATTGCTGGG + Intergenic
1144657510 17:17046419-17046441 AACCCAGCCATTCTATTTATAGG - Intronic
1145203140 17:20964938-20964960 AACCTAGCAATCTTATTACTGGG - Intergenic
1146866667 17:36341956-36341978 AACCTAGGAATGGAATTGCTGGG + Intronic
1147047038 17:37760460-37760482 AATCTAGCAATTCTATTTCTGGG + Intergenic
1147069535 17:37942565-37942587 AACCTAGGAATGGAATTGCTGGG + Intergenic
1147081065 17:38022103-38022125 AACCTAGGAATGGAATTGCTGGG + Intronic
1147097007 17:38146060-38146082 AACCTAGGAATGGAATTGCTGGG + Intergenic
1148345253 17:46898892-46898914 TACCTAGGAATGCAATTGCTGGG - Intergenic
1149025394 17:52021323-52021345 AACCAAGCAATCCCATTGCTGGG - Intronic
1149142938 17:53456198-53456220 AACCTATGTATGCTATTGATGGG - Intergenic
1149162932 17:53716527-53716549 AACCCAGCAATTCTATTATTGGG - Intergenic
1149889874 17:60378425-60378447 AACCTAGGAATGGAATTGCTGGG - Intronic
1150189386 17:63221875-63221897 GACCTAGCCATGCTATTCCTAGG + Intronic
1150439688 17:65181159-65181181 TACCTAGTAATGCGATTGCTGGG + Intronic
1150863812 17:68828273-68828295 AACCCAGCAATCCTACTGCTGGG - Intergenic
1150921460 17:69488399-69488421 GACCTAGCAATCCCATTGCTGGG + Intronic
1151882051 17:76901851-76901873 AACCTAGCCAGGCTCTTGAATGG + Intronic
1153106235 18:1530671-1530693 AACCTAGTAATGGGATTGCTGGG - Intergenic
1153454664 18:5267294-5267316 AACCTAGCAATCCCATTACTGGG + Intergenic
1154015859 18:10616562-10616584 AACCTCACAATGCAATTGAGAGG - Intergenic
1154179049 18:12113771-12113793 AACCTAGCAATCTTATTACTGGG + Intronic
1154189652 18:12219080-12219102 AACCTCACAATGCAATTGAGAGG + Intergenic
1155230421 18:23768616-23768638 AACCCAGTAATCCTATTAATTGG + Intronic
1155776973 18:29776911-29776933 AACCCAGCAATTCCATTGCTGGG - Intergenic
1155812498 18:30255298-30255320 GACCCAGCAATGCTATTGCTGGG + Intergenic
1155814372 18:30286771-30286793 GACCTGGCAATGCCATTGCTAGG + Intergenic
1156372869 18:36487161-36487183 AACCCAGCAATTCTATTTCTAGG - Intronic
1156934437 18:42686165-42686187 AACCTAGCAATCCCATTACTGGG - Intergenic
1157448231 18:47764433-47764455 AACCCAGCAATCCTATTACTGGG + Intergenic
1159714626 18:71806170-71806192 AACCTGGCAATGCCATTACTGGG + Intergenic
1162262959 19:9547517-9547539 AACCTTTCATTGCTATTCATGGG - Intergenic
1164081210 19:21862903-21862925 AACCTTTCATTGCTATTCATAGG - Intergenic
1165189452 19:34050462-34050484 AACCCAGCAATCCCATTGCTGGG + Intergenic
1165985322 19:39763696-39763718 TACCCAGCAATGGTATTGCTGGG - Intergenic
1166581863 19:43908033-43908055 TAATTAGCAATGCTATTGGTAGG + Intergenic
1168478703 19:56698539-56698561 AACCCAGCAATCCTATTGCTGGG - Intergenic
1168479712 19:56709250-56709272 AACCCAGCAATCCTATTATTGGG - Intergenic
925782649 2:7396607-7396629 TACCTAGCAATGGGATTGTTGGG + Intergenic
925983353 2:9194726-9194748 GACCCAGCAATGCTATTACTGGG - Intergenic
928767307 2:34662601-34662623 TACCTTGCAATGTTATTGCTGGG + Intergenic
928931924 2:36633719-36633741 GACCTAGCAATCCTATTACTGGG - Intronic
928933795 2:36653014-36653036 GACCCAGCAATACTATTGCTAGG + Intergenic
928933796 2:36653016-36653038 TACCTAGCAATAGTATTGCTGGG - Intergenic
929280580 2:40073375-40073397 TACCCAGTAATGGTATTGATGGG + Intergenic
929886149 2:45880386-45880408 AATCCAGCAATGCTACTAATGGG - Intronic
930098344 2:47584281-47584303 AACCTTTCACTGCTATTCATGGG + Intergenic
930594366 2:53367845-53367867 AATCTTGCATTGCTATTGAAAGG - Intergenic
931029905 2:58161957-58161979 CACCTAGCAAAGCTATTGTAGGG + Intronic
931798439 2:65734616-65734638 AACCTAGCAATCCCATTACTGGG - Intergenic
933347871 2:81112553-81112575 TACCCAGCAATGCGATTGCTGGG - Intergenic
934622082 2:95818032-95818054 AACCTAGTAATGGGATTGCTGGG + Intergenic
934811367 2:97280749-97280771 AACCTAGTAATGGGATTGCTGGG - Intergenic
934826324 2:97427191-97427213 AACCTAGTAATGGGATTGCTGGG + Intergenic
934892452 2:98082556-98082578 AACCTAGAAATGAAATTGTTTGG + Intergenic
935151809 2:100443889-100443911 AAGCCAGCAATCCTATTGTTGGG + Intergenic
936488851 2:112952482-112952504 GACCCAGCAATCCTATTGCTGGG + Intergenic
936692352 2:114905662-114905684 AACCTAGCAATCCCATTACTGGG + Intronic
939089525 2:137762793-137762815 AACCTAGCAATCCTGTTATTAGG + Intergenic
940072584 2:149705683-149705705 GACCTAGCAATTCTACTGCTGGG - Intergenic
940563252 2:155328931-155328953 AACCTAGCAATATCATTGCTGGG + Intergenic
940563253 2:155328933-155328955 TACCCAGCAATGATATTGCTAGG - Intergenic
940629929 2:156225415-156225437 CACCTAGCAATCCCATTGCTGGG + Intergenic
940726789 2:157343878-157343900 AACCTTTCACTGCTATTCATGGG - Intergenic
941088044 2:161141843-161141865 GACCCAGCAATCCTATTAATGGG - Intronic
942819454 2:180094428-180094450 AACCTAGCAATCCCATTATTGGG - Intergenic
942824154 2:180153674-180153696 AACCCAGCAATGCCATTACTGGG - Intergenic
943187378 2:184628767-184628789 AACCTGGCAATTCTATTTCTAGG - Intronic
944127158 2:196307167-196307189 AAAATACCAATGCTATTGATGGG - Exonic
944475760 2:200103846-200103868 AACTCAGCAATCCTATTAATGGG - Intergenic
944537111 2:200721980-200722002 AACCCAGCAATTCCATTGCTGGG + Intergenic
944566916 2:201000693-201000715 GACCTAGCAATTCTATTCCTAGG + Intronic
945620143 2:212125932-212125954 AACCTAGCAATCCCATTACTGGG - Intronic
945858537 2:215094703-215094725 AACCTTTCACTGCTATTCATGGG - Intronic
946591272 2:221250714-221250736 AACCTAGCAATCCTATTATTGGG + Intergenic
947150017 2:227105992-227106014 AAACTACTAATGCTTTTGATAGG + Intronic
948303686 2:236930449-236930471 AACCTAGCAATCCCATTACTGGG + Intergenic
1168744405 20:225873-225895 GACCTAGCAATCCTATTACTGGG + Intergenic
1169002027 20:2174825-2174847 AACCCAGCAATTGTATTTATAGG + Intronic
1169837548 20:9897326-9897348 AACATAGTAATGGTGTTGATAGG + Intergenic
1170798066 20:19567136-19567158 GACCTAGCAATCCTATTACTGGG + Intronic
1172402501 20:34661727-34661749 TACCTAGTAATGGGATTGATGGG + Intronic
1173455659 20:43199361-43199383 AACCCAGTAAAGCTATTTATTGG + Intergenic
1174779381 20:53374504-53374526 AACCCAGCAATGCCATTACTGGG - Intronic
1174964344 20:55194474-55194496 AACCTAGCAATCCCATTACTGGG + Intergenic
1174991705 20:55517974-55517996 AACCCAGCAATCCCATTGTTGGG - Intergenic
1175376286 20:58526558-58526580 AACATAGCAATCCTACTTATCGG - Intergenic
1177750865 21:25282559-25282581 AACCTAGTAATGAGATTGCTGGG - Intergenic
1177831974 21:26149136-26149158 AGCCTTGGAATGCAATTGATTGG - Intronic
1177871504 21:26578557-26578579 AACCCAGCAATCCCATTGCTGGG - Intergenic
1177914159 21:27067626-27067648 AACCTAGCAATCCCATTACTGGG + Intergenic
1178056526 21:28805268-28805290 AAGCTAGAACTGCTATAGATGGG - Intergenic
1178099271 21:29249674-29249696 AACCTAGCAATCCCATTACTGGG - Intronic
1180457098 22:15519004-15519026 GACCCAGCAATGCCATTGGTAGG + Intergenic
1180572591 22:16741979-16742001 AACCTAGCAATCCCATTACTGGG - Intergenic
1181972810 22:26705400-26705422 AACCTAGCAGTCCTATTACTGGG - Intergenic
1182682389 22:32090742-32090764 CACCTAGGAATGGAATTGATGGG + Intronic
1183443478 22:37837286-37837308 AACCTAGGAATGGCATTGTTGGG - Intronic
1184647667 22:45905043-45905065 AACCTAGCAATCCCATTCCTGGG - Intergenic
949367232 3:3295969-3295991 GACCTAGCAATCCTATTACTGGG + Intergenic
950270095 3:11607066-11607088 AACCTAGCAATTCTAGTCCTGGG + Intronic
950363535 3:12466869-12466891 GACCTAGCAATTCTACTCATAGG + Intergenic
951250862 3:20393115-20393137 GACCTAGCAATGGGATTAATGGG - Intergenic
952297567 3:32074646-32074668 AACCTTTCACTGCTATTCATGGG - Intronic
953263233 3:41360394-41360416 AACCCAGCAATCCTATTAGTGGG + Intronic
953834065 3:46328088-46328110 AACCTTTCATTGCTATTCATAGG + Intergenic
955749393 3:62172262-62172284 GACCCAGCAATGCTATTCCTAGG - Intronic
956164986 3:66391292-66391314 AACCTAGGAATGGAATTGCTGGG - Intronic
956262001 3:67354231-67354253 AACTTAAAAATGTTATTGATTGG - Intergenic
956940290 3:74152718-74152740 AACCAAGCAATTCTATTTCTAGG + Intergenic
957105093 3:75876902-75876924 AACCTAGCAATCCCATTACTGGG + Intergenic
957346066 3:78963111-78963133 TACCTTGCAATGCTGATGATAGG + Intronic
957532270 3:81455638-81455660 AACCCAGCAATCCCATTAATGGG + Intergenic
958077217 3:88696154-88696176 AACCTAGCAATTCCATTACTGGG + Intergenic
958512574 3:95067200-95067222 AACCTAGCAATCTTATTATTGGG + Intergenic
958794075 3:98687485-98687507 GACCTAGCAATCCTATTACTAGG + Intergenic
958802262 3:98770017-98770039 AACCTAGCAATTCTAACTATGGG + Intronic
959677510 3:109053248-109053270 AACCCAGCAATCCTATTACTGGG + Intronic
959798392 3:110460144-110460166 CACCCAGCAATTCTATTCATAGG + Intergenic
960755999 3:121013210-121013232 AACCTAGCAATCCCATTAATGGG - Intronic
961031956 3:123613926-123613948 TACCTAGCAGCGTTATTGATGGG - Exonic
961097436 3:124169632-124169654 GACCAATCAATGCCATTGATTGG - Intronic
961141078 3:124556866-124556888 AACTTAGCAACCCTATTCATAGG - Intronic
961583925 3:127906660-127906682 TACCTAGCAATGGGATTGCTGGG - Intergenic
961641915 3:128370253-128370275 AACCTAGCATTGCCTATGATGGG - Intronic
962047895 3:131780307-131780329 AACCTAGCAATCCTATTACTGGG + Intronic
962382728 3:134910508-134910530 AGCCAGTCAATGCTATTGATTGG + Intronic
963561324 3:146869521-146869543 AACCTAGCAATCCCATTGCTGGG - Intergenic
963879063 3:150506984-150507006 GACCTAGCAATCCCATTGCTGGG - Intergenic
964253026 3:154742250-154742272 AACCCAGCAATCCCGTTGATGGG + Intergenic
965123125 3:164589404-164589426 AACCCAGCAATCCTATTACTGGG - Intergenic
966341736 3:178932775-178932797 AACCTAGCAATCCCATTGCTGGG + Intergenic
966600007 3:181765630-181765652 GACCTAGCTATGCTATAGACAGG + Intergenic
966679234 3:182623285-182623307 AACCTAGCAATTCTACTTCTAGG + Intergenic
966764168 3:183444858-183444880 GACCTAGCAATTCTATTTCTAGG - Intergenic
966859594 3:184222590-184222612 GACCTAGCAATTCTATTCCTGGG + Intronic
966998237 3:185306293-185306315 AACCTAGCAATTCCATTTCTGGG - Intronic
967560708 3:190915943-190915965 TACCTAGCAATGAGATTGCTGGG + Intergenic
967635643 3:191799578-191799600 AACCCAGCAATCCTATTACTGGG + Intergenic
968175013 3:196542116-196542138 GACCTAGCAATTCTATTTTTAGG - Intergenic
968247716 3:197170272-197170294 AACCCAGCAATCCTATTACTGGG - Intronic
968322072 3:197778901-197778923 AACCTAGCAATTCTACTCCTAGG - Intronic
968412341 4:401108-401130 AACCTTTCACTGCTATTCATGGG + Intergenic
970089141 4:12385461-12385483 TACCCAGCAATGGGATTGATGGG - Intergenic
970363118 4:15330056-15330078 AACCTAGCAATTCCATTCTTAGG - Intergenic
970552051 4:17191950-17191972 AAACTAACGATGCTATTAATAGG - Intergenic
970630622 4:17939442-17939464 AACCCAGCAATTCTACTCATAGG + Intronic
971390364 4:26179795-26179817 AACCCAGCAATACCATTGCTGGG + Intronic
971390365 4:26179797-26179819 TACCCAGCAATGGTATTGCTGGG - Intronic
971526282 4:27622467-27622489 AACCTAGCAATCCTATTACTGGG + Intergenic
971607231 4:28673349-28673371 AAACCATCAGTGCTATTGATTGG - Intergenic
972057258 4:34818874-34818896 AACCCAGCAATCCCATTGCTGGG + Intergenic
972083033 4:35178136-35178158 AACCCAGCAATGCCATTACTAGG + Intergenic
972153190 4:36122245-36122267 AACCCAGCAATCCTATTACTAGG + Intronic
972451375 4:39202621-39202643 ACCCTAGAAATGGTATTGTTAGG - Intronic
972662310 4:41128389-41128411 AACCCAGCAATCCCATTGTTGGG + Intronic
973149682 4:46871949-46871971 AACCCAGCAATCCTATTATTGGG + Intronic
973771396 4:54210374-54210396 TACCTAGGAATGAAATTGATGGG - Intronic
974198320 4:58605541-58605563 AACCCAGCAATGCCATTACTAGG - Intergenic
974568641 4:63613103-63613125 GACCTAGCACTCCTATTAATAGG + Intergenic
974749261 4:66115413-66115435 GACCCAGCAATCCTATTAATGGG + Intergenic
974785420 4:66613550-66613572 AACCTAGCAATCCCATTACTGGG - Intergenic
974895871 4:67937920-67937942 AACCTAGCAATCCTCTTACTGGG - Intronic
974955527 4:68636426-68636448 GACCCAGCAATGCCATTGCTGGG - Intronic
974964361 4:68742305-68742327 TACCCAGTAATGCGATTGATGGG - Intergenic
975639323 4:76483624-76483646 GACCTAGCAATCCTATTACTGGG + Intronic
975899697 4:79137770-79137792 AACCCAGCAATCCTATTACTGGG + Intergenic
975904306 4:79191185-79191207 AACCCAGCAATCCCATTGCTGGG - Intergenic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
978042194 4:104081200-104081222 AATCTAGCAATCCTACTGCTGGG + Intergenic
978078254 4:104560393-104560415 AACCCAGCAATCCTATTAATGGG - Intergenic
978437154 4:108698075-108698097 AAGCTAGGAATGCTATTTTTAGG - Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978900228 4:113940119-113940141 AACCCAGCAATGAAATTGCTGGG - Intronic
979487966 4:121290399-121290421 GACCCAGCAATCCTATTGCTGGG + Intergenic
979505831 4:121495860-121495882 TACCCAGCAATGCCATTGCTGGG + Intergenic
980192978 4:129548631-129548653 TACCTAGCATTGCTGTTGAATGG + Intergenic
980424669 4:132612046-132612068 AACATTGCAATTCTATTGATTGG - Intergenic
980519761 4:133916530-133916552 GACCTAGCAATCCCATTAATGGG - Intergenic
981079070 4:140620304-140620326 AACCCAGCAATGCCATTACTGGG - Intergenic
981289181 4:143054116-143054138 AACCTAGCAATCCCATTACTGGG - Intergenic
981325715 4:143445105-143445127 AACCTAGCAATTCCATTACTGGG - Intronic
981388446 4:144158900-144158922 AACCCAGCAATCCTATTACTGGG - Intergenic
981500198 4:145442021-145442043 AACCCAGCAATCCTATTACTGGG + Intergenic
982336840 4:154249546-154249568 GACCCAGCAATCCTATTGCTGGG + Intronic
982834511 4:160107702-160107724 TAGCTAGCAATGTTATTGTTAGG + Intergenic
982943839 4:161592783-161592805 AACCCAGCAATGGGATTGCTGGG + Intronic
983256574 4:165407102-165407124 AACCTAGCAGTGGAATTGCTGGG + Intronic
983492146 4:168400379-168400401 AACCCAGCAATCCCATTGCTGGG - Intronic
983715645 4:170778019-170778041 CACCTAGCAATGGGATTGCTGGG - Intergenic
984056356 4:174933988-174934010 AACCTAGCAATCATATTACTGGG - Intronic
984161286 4:176255343-176255365 AACCTAGCAATCCCATTACTGGG + Intronic
984306831 4:178003524-178003546 AATCCAGCAATTCTATTCATTGG - Intergenic
984953874 4:185026259-185026281 AACCTAGCAATTCTATTCATTGG - Intergenic
985237003 4:187885985-187886007 AACCTAGCAATCCCATTACTGGG - Intergenic
985562771 5:599689-599711 AACCTAGCAATCCCATTACTGGG - Intergenic
986347450 5:6847938-6847960 AACCCAGCAATCCCATTGCTGGG - Intergenic
987468529 5:18301828-18301850 AACCCAGTAATGCGATTGCTAGG + Intergenic
987806337 5:22774106-22774128 AACCCAGCAATCCTATTACTTGG + Intronic
987914673 5:24196533-24196555 AACCTAACAATCCTTTTAATGGG - Intergenic
987966942 5:24889732-24889754 AACCTAGCAATTCTATTACTTGG + Intergenic
988005831 5:25408728-25408750 GACCTAGCAATCCCATTAATGGG - Intergenic
988075559 5:26349507-26349529 AAACAAGCAAGGCTATTGATAGG - Intergenic
988088388 5:26502479-26502501 AACCCAGCAATCTTATTAATGGG + Intergenic
988645360 5:33089539-33089561 AACCTAGCAATCCTGTTAGTGGG - Intergenic
988869936 5:35378163-35378185 AACCTAGCAATCCTATTACTGGG + Intergenic
989026941 5:37078561-37078583 TACCCAGCAATGGTATTGCTGGG + Intergenic
989161090 5:38392471-38392493 AACCCAGCAATGCCATTAGTGGG - Intronic
989422640 5:41257532-41257554 AACCCAGCAGTCCTATTGCTGGG - Intronic
989825835 5:45853492-45853514 AACCCAGCAATCCCATTGCTGGG + Intergenic
990790861 5:59477677-59477699 AACCTAGCAATCCCATTACTGGG + Intronic
992276008 5:75119612-75119634 AACCTAGCAATTCCATTACTGGG - Intronic
992310706 5:75496449-75496471 AACCTAGCAATCCCATTCATAGG + Intronic
992313906 5:75532600-75532622 AACCTGGCAATGCCATTACTAGG - Intronic
992345762 5:75876047-75876069 AACCCAGCAATGCAATTACTGGG + Intergenic
992465281 5:76998256-76998278 TACCTAGTAATGGTATTGGTGGG - Intergenic
993084334 5:83344767-83344789 AACCTAGGAATTCTACTCATAGG - Intronic
993417225 5:87649986-87650008 AACATACCAATGATATTGAAGGG + Intergenic
993818722 5:92586712-92586734 AACCCAGCATTTCTATTCATAGG + Intergenic
993894304 5:93513291-93513313 AACCTAGCAATCCCATTACTGGG + Intergenic
994325302 5:98439632-98439654 AACCTTTCATTGCTATTCATGGG - Intergenic
994429052 5:99632372-99632394 AACCTAGCAATCCCATTACTGGG - Intergenic
994441012 5:99802468-99802490 AATCCAGCAATACCATTGATGGG - Intergenic
994535935 5:101029430-101029452 GACCTAGCAATCCTATTACTGGG + Intergenic
994588518 5:101743023-101743045 AACCCAGTAATGGTATTGCTGGG + Intergenic
994645741 5:102466536-102466558 AGCCTAGCAATCCTATTACTGGG - Intronic
995099913 5:108287743-108287765 AACCCAGCAATCCCATTGTTGGG + Intronic
995188494 5:109296400-109296422 AACCCAGCAATCCCATTGCTAGG + Intergenic
995188495 5:109296402-109296424 TACCTAGCAATGGGATTGCTGGG - Intergenic
995322882 5:110857058-110857080 TACCCAGCAATGATATTGCTGGG - Intergenic
995948302 5:117678496-117678518 CACCTAGAACTGCTATTGTTAGG + Intergenic
996193506 5:120574873-120574895 AACCTAGAAATTCCATTTATAGG + Intronic
997772131 5:136565012-136565034 GACCCAGCAATGCTATTAAAGGG - Intergenic
998574981 5:143305372-143305394 AACCTAGCAATCCTATTGCTGGG + Intronic
998634389 5:143936820-143936842 AATCCAGCAATGCTACTGTTGGG + Intergenic
999942168 5:156554749-156554771 TACCTAGGAATGCAATTGCTGGG + Intronic
1000428584 5:161122753-161122775 ATCCTAGCAATTCTATTTCTAGG + Intergenic
1000538897 5:162514183-162514205 GATCTAGCAATCCTATTGCTAGG - Intergenic
1000791074 5:165607745-165607767 AACCCAGCAATCCTATTACTGGG - Intergenic
1002850001 6:985560-985582 AACCCAGCAATCCCATTAATGGG - Intergenic
1003186673 6:3838119-3838141 AACCTAGCAATCCTATTTATAGG + Intergenic
1004795461 6:19078620-19078642 GATCTAGCAATCCTATTGCTGGG + Intergenic
1005238545 6:23795292-23795314 GACCTAGCAATCCTATTACTGGG + Intergenic
1005251369 6:23949950-23949972 GACCTAGCAATCCTATTTCTGGG + Intergenic
1005369873 6:25121272-25121294 AACCTAGGAATGGAATTGCTGGG - Intergenic
1006266066 6:32924860-32924882 AACCCAGCAATTCCATTGTTGGG - Intergenic
1008304079 6:49879573-49879595 TACCTAGCAATGGAATTGCTAGG + Intergenic
1008304080 6:49879575-49879597 ATCCTAGCAATTCCATTGCTAGG - Intergenic
1008802021 6:55380137-55380159 GACCTAGCAATCCCATTGCTGGG - Intronic
1009570972 6:65383928-65383950 AACCTAGCAATGTTACTTGTAGG - Intronic
1009576044 6:65461916-65461938 GACTTAGCAATGCTATTCTTGGG + Intronic
1009597566 6:65755027-65755049 GACCTAGCAATCCTATTACTGGG + Intergenic
1009838044 6:69030244-69030266 TACCTAGCAATGGGATTGCTGGG - Intronic
1010647902 6:78414889-78414911 TACCCAGCAATGATATTGCTGGG - Intergenic
1010682848 6:78817388-78817410 AACCTAGCAATCCCATTACTGGG + Intergenic
1010907051 6:81503516-81503538 TACCTAGCAATGGGATTGCTGGG - Intronic
1011021303 6:82816239-82816261 TACCTAGCAATGGGATTGCTGGG - Intergenic
1011096365 6:83669175-83669197 AACCTAGCAATTCTCTTTCTAGG - Intronic
1011938782 6:92816385-92816407 AACCTAGCAATCCAATTACTGGG + Intergenic
1012070824 6:94613579-94613601 AACCTAGTAATGCGGTTGGTGGG - Intergenic
1012201882 6:96416726-96416748 AACCCAGCAATGCCATTATTGGG + Intergenic
1012657670 6:101845674-101845696 AACTCAGCAATGCTATTCTTAGG - Intronic
1013314827 6:108931436-108931458 AACCCAGCAATCCTATTACTGGG - Intronic
1013573892 6:111459895-111459917 AACCTAGCAATCCCATTACTGGG + Intronic
1013756581 6:113469122-113469144 GACCTAGCCATCCTATTGCTGGG + Intergenic
1014334870 6:120120656-120120678 AACCTAGCAATTCCATTACTAGG - Intergenic
1014359088 6:120452876-120452898 GACCTAGCAATTCTATTACTGGG + Intergenic
1014481379 6:121941780-121941802 AACCCAGCAATGCCATTATTGGG - Intergenic
1014487485 6:122017233-122017255 GACCTAGCAATCCCATTGTTGGG - Intergenic
1014716841 6:124875623-124875645 AACCTAGCAATCCCATTACTGGG + Intergenic
1015325659 6:131920503-131920525 TACCTAGCAATGCTACTACTGGG + Intergenic
1015858443 6:137650876-137650898 GACCTAGCAATTCTATTCCTAGG + Intergenic
1017922119 6:158881916-158881938 AACCTTTCACTGCTATTCATGGG + Intronic
1018109018 6:160517542-160517564 TACCTAGCAATGGAATTGCTGGG - Intergenic
1018355781 6:163014369-163014391 AACCAAGCAATCCCATTAATGGG - Intronic
1019086482 6:169482311-169482333 AACCTAGCAATCCCATTACTTGG - Intronic
1019865438 7:3705567-3705589 CATGTAGCAATGCTACTGATTGG + Intronic
1020398338 7:7744434-7744456 AACCTAGCAATTCTACTCCTAGG - Intronic
1020735536 7:11944522-11944544 AACCTAGCAATCCCATTATTGGG - Intergenic
1022059920 7:26783329-26783351 AACCTAGTAACGGTATGGATTGG - Intronic
1023385348 7:39651276-39651298 AACCTAACAATGGTTTTGTTGGG + Intronic
1024702131 7:51915465-51915487 CACCTAGCAATGGAATTGTTGGG - Intergenic
1024831222 7:53460349-53460371 AACCCAGCAATCCCATTAATGGG + Intergenic
1026233105 7:68502661-68502683 AAACTAGCAAAGCCATTGACTGG + Intergenic
1026510752 7:71025442-71025464 AACCCAGCAATGCTATTATTGGG + Intergenic
1026708725 7:72717944-72717966 AACCTAGCAATCCCATTACTGGG + Intronic
1027635049 7:80661271-80661293 AACCTAATAATTCTAATGATAGG - Intronic
1028185470 7:87780142-87780164 TACCTAGTAATGGTATTGCTGGG + Intronic
1028242122 7:88434260-88434282 TACCTAGTAATGGGATTGATGGG - Intergenic
1028315967 7:89403718-89403740 GACCTAGCAATCCTATTACTGGG - Intergenic
1028354753 7:89892667-89892689 GACCTAGCAATACTACTCATAGG - Intergenic
1028661988 7:93288493-93288515 AACCTAGCAATTCTACTTCTAGG - Intronic
1028767970 7:94581888-94581910 AACCCAGCAATCCCATTGCTGGG - Intergenic
1028865646 7:95708418-95708440 AACCCAGCAATCCTATTACTGGG + Intergenic
1029108963 7:98202217-98202239 AATCTAGCAATTCAATGGATGGG - Intronic
1030295529 7:107922182-107922204 GACCCAGCAATGCTATTACTGGG - Intronic
1030440917 7:109588181-109588203 AACCCAGCAATGCCATTTACTGG + Intergenic
1031385903 7:121150562-121150584 TACCTAGTAATGGTATTGTTGGG + Intronic
1031636219 7:124104186-124104208 AACATAGGATTGCTATTGTTGGG + Intergenic
1031651690 7:124299208-124299230 TACCTAGTAATGGTATTGCTGGG + Intergenic
1032482771 7:132260136-132260158 AACCTAGCAATCCCATTACTAGG + Intronic
1032718315 7:134529719-134529741 AACCTAGCCAAGCCAATGATGGG - Intronic
1032723153 7:134567257-134567279 AACCTAGCCAAGCCAATGATGGG - Intronic
1034742267 7:153487359-153487381 AACCTAGCAATCCCATTACTGGG - Intergenic
1037244719 8:16820030-16820052 AACCCAGCAATTCTATTCCTAGG + Intergenic
1038867100 8:31451108-31451130 AACCTAGCAATCCCATTACTGGG + Intergenic
1038905040 8:31891614-31891636 AGCCTAGGAATGCAATTGCTGGG - Intronic
1039282332 8:35999125-35999147 AACCCAGCAATTCTATTACTGGG - Intergenic
1039678567 8:39702001-39702023 AACCCAGCAATCCTATTTCTGGG - Intronic
1041075726 8:54167936-54167958 AACCTAGCAATCCCATTACTGGG + Intergenic
1041586102 8:59521710-59521732 AACCTAGCAATCCTATTTTGGGG + Intergenic
1041931879 8:63295913-63295935 AACCCAGCAATCCTATTACTGGG + Intergenic
1042124442 8:65523653-65523675 AACCCAGCAATCCTACTGCTAGG + Intergenic
1042288604 8:67142680-67142702 AACCCAGCAATTCTATTCCTAGG - Intronic
1042986598 8:74590714-74590736 TACCTAGTAATGGTATTGCTGGG - Intergenic
1043046599 8:75331619-75331641 AACCTAGCAATACTAAGTATTGG - Intergenic
1043248606 8:78038301-78038323 AACCCAGCAATCCCATTGTTGGG - Intergenic
1043550462 8:81366038-81366060 AACCCAGCAATTCTATTACTGGG - Intergenic
1044001110 8:86882647-86882669 AACCTAGCAATCCCATTATTTGG + Intronic
1045784981 8:105910361-105910383 AACTTAGCAATCCTCTTAATTGG + Intergenic
1045877113 8:106994622-106994644 AACCGAAAAATGCTATTTATGGG - Intergenic
1046156401 8:110295612-110295634 AACCTGGCAATCCTATTACTGGG + Intergenic
1046366794 8:113243625-113243647 AATCTAGCAATTCTAGTCATAGG - Intronic
1047575895 8:126154967-126154989 AACCTAGCAATCCCATTAGTAGG + Intergenic
1047870853 8:129080271-129080293 AACCTAGCAATCACATTGTTGGG - Intergenic
1047882235 8:129208287-129208309 AACCCAGAAATTCTATTCATAGG + Intergenic
1050569044 9:6918533-6918555 GACCCAGCAATCCTATTGATGGG - Intronic
1050617613 9:7418914-7418936 AACCCAGCAATCCTATTGTTGGG + Intergenic
1050646280 9:7723155-7723177 AACCCAGCAATGCCATTACTGGG - Intergenic
1050810618 9:9741966-9741988 TACCTAGTAATGCAATTGTTGGG + Intronic
1051199604 9:14601624-14601646 AACCCAGCAATCCCATTAATGGG + Intergenic
1052068667 9:24054842-24054864 GACCTAGCAATTCGATTGCTGGG + Intergenic
1052363768 9:27588870-27588892 ATCCTAGCAATTCTATGAATGGG - Intergenic
1052393504 9:27909422-27909444 AACCCAGCAATTCTATTATTGGG + Intergenic
1052501243 9:29293031-29293053 GACCTAGCAATCCCATTGTTGGG - Intergenic
1053307071 9:36992309-36992331 AACCTAGCAATGCTATTGATTGG - Intronic
1053563919 9:39227092-39227114 AACCTAGCAATCCCATTACTGGG - Intronic
1053650501 9:40164135-40164157 AACCTAGTAATGGGATTGCTGGG - Intergenic
1053829705 9:42064971-42064993 AACCTAGCAATCCCATTACTGGG - Intronic
1054133229 9:61391952-61391974 AACCTAGCAATCCCATTACTGGG + Intergenic
1054331011 9:63755908-63755930 AACCTAGTAATGGGATTGCTGGG - Intergenic
1054600854 9:67122483-67122505 AACCTAGCAATCCCATTACTGGG + Intergenic
1054982295 9:71221002-71221024 ATCCCAGTAATGCTCTTGATTGG - Intronic
1055148734 9:72968280-72968302 AACCCAGCAATCCTATTACTTGG - Intronic
1055415476 9:76077920-76077942 AACCTAGCAATTCCATTACTGGG - Intronic
1055675413 9:78654360-78654382 AACCTATCAATGATATTAACTGG + Intergenic
1055866742 9:80823425-80823447 AACCCAGCAATGCCATTACTAGG + Intergenic
1056054982 9:82812420-82812442 AACCTAGCAATCCCATTACTGGG + Intergenic
1058106250 9:100975407-100975429 AACCTAGCAATCCCATTACTGGG - Intergenic
1058238366 9:102522888-102522910 AACCTAGCAATTCCATTATTGGG - Intergenic
1059870937 9:118575357-118575379 AACCCAGCAATCTTATTGCTGGG - Intergenic
1059966521 9:119619879-119619901 AACCCAGCAATCCCATTGCTGGG - Intergenic
1059978275 9:119741339-119741361 GACCCAGCAATTCTATTAATAGG - Intergenic
1060013862 9:120069187-120069209 GACCCAGCAAAGATATTGATTGG + Intergenic
1061741891 9:132713069-132713091 AACCTAGCAATTCCATTCCTGGG + Intergenic
1202798388 9_KI270719v1_random:148825-148847 AACCTAGTAATGGGATTGCTGGG - Intergenic
1185882470 X:3753807-3753829 AACCCACCAATCCTATTGCTGGG + Intergenic
1186921210 X:14282688-14282710 TATCTAGCAATGCTGTTGCTGGG - Intergenic
1186983037 X:14978709-14978731 GACCTAGCAATTCCATTTATAGG + Intergenic
1187289222 X:17936350-17936372 AACCCAGCAATCCCATTGTTGGG - Intergenic
1187637257 X:21243318-21243340 GACCCAGCAATGCTATTACTGGG - Intergenic
1188027234 X:25222822-25222844 AACCTAGCAATCCCATTACTGGG - Intergenic
1188270144 X:28128902-28128924 AACCCAGCAATCCCATTGCTGGG - Intergenic
1188573484 X:31617701-31617723 AACCCAGCAATGCCATTACTGGG + Intronic
1188681609 X:33015143-33015165 AACCTAGCAATCCCATTACTGGG + Intronic
1188717804 X:33482057-33482079 GACCTAGCAATCCCATTGCTGGG + Intergenic
1188817776 X:34736537-34736559 AACCCAGCAATGCCATTATTAGG - Intergenic
1188833180 X:34926316-34926338 AACATAGAAATTCCATTGATGGG + Intergenic
1189154404 X:38742131-38742153 AACCTAGCAATCCCATTACTGGG - Intergenic
1189526929 X:41832489-41832511 GACCTAGCAATTCTATTCCTGGG + Intronic
1189657303 X:43258496-43258518 GACCTAGCAATGCCATTACTGGG - Intergenic
1189911451 X:45814430-45814452 CACCTAGCAATGAGATTGCTGGG - Intergenic
1190859903 X:54334801-54334823 AAACTAGCAATTCTACTTATAGG + Intronic
1191190763 X:57664669-57664691 AACCTAGCAGTCCTATTACTGGG + Intergenic
1192164005 X:68813024-68813046 GACCTAGCAATTCTATTCCTAGG + Intergenic
1192697038 X:73428267-73428289 GACCTAGCAATCCTATTACTAGG - Intergenic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1192767216 X:74153058-74153080 AACATAGCAATCCCATTGGTGGG + Intergenic
1192913740 X:75633126-75633148 AACCTTTCACTGCTATTCATGGG + Intergenic
1192916648 X:75658578-75658600 AACCCAGCAATTCCATTGCTGGG + Intergenic
1193607927 X:83591212-83591234 AACCCAGCAATCCTATTAATGGG - Intergenic
1193836975 X:86355373-86355395 AACCCAGCAATCCTATTACTGGG - Intronic
1193859390 X:86645528-86645550 GACCCAGCAATGCTATTACTGGG + Intronic
1193894343 X:87093583-87093605 GACCCAGCAATCCTATTAATGGG - Intergenic
1193913426 X:87334313-87334335 AATCTAGCAATCCTATTACTAGG - Intergenic
1194072558 X:89345014-89345036 TACCCAGCAATGAGATTGATGGG + Intergenic
1194078613 X:89429829-89429851 GACCTAGCAATTCAATTAATGGG - Intergenic
1194137652 X:90166476-90166498 GACCCAGCAATCCTATTGCTGGG + Intergenic
1194198116 X:90921221-90921243 AACCTAGTATTGCAATTAATTGG + Intergenic
1194487430 X:94502632-94502654 GACCTAGCAATCCCATTGCTGGG - Intergenic
1194536681 X:95113858-95113880 TACCTAGTAATGGTATTGCTGGG + Intergenic
1194805640 X:98324159-98324181 TACCTAGCAATGTGATTGCTGGG - Intergenic
1194982929 X:100459055-100459077 AACCCAGCAATCCCATTGTTGGG + Intergenic
1195456905 X:105079297-105079319 GACCTAGCAATCCTATTACTGGG + Intronic
1196219754 X:113098977-113098999 AACCCAGTAATGCAATTGCTAGG + Intergenic
1196554164 X:117067287-117067309 AACCTAGCAATTCTATTACTAGG - Intergenic
1196971025 X:121108833-121108855 AACCTAGCAATCCCATTACTGGG - Intergenic
1197093329 X:122564919-122564941 AACCTAGCAATCCTACTACTGGG + Intergenic
1197100677 X:122650666-122650688 TACCTAGCAATCCTACTGCTAGG + Intergenic
1197208219 X:123808286-123808308 AACCTGTAAATGCTTTTGATAGG + Intergenic
1197357203 X:125450189-125450211 GACCTAGCAATCCCATTGCTGGG + Intergenic
1197408260 X:126082585-126082607 GACCCAGCAATCCTATTGTTGGG - Intergenic
1197428725 X:126331492-126331514 AACCCAGCAATCCCATTGCTGGG - Intergenic
1197904832 X:131413552-131413574 AACCCAGCAATCCTATTACTTGG + Intergenic
1198094392 X:133364291-133364313 TACCTAGCAATGGAATTGCTTGG + Intronic
1198570429 X:137949420-137949442 AATCTAGCAATCCTATTTCTGGG - Intergenic
1198777940 X:140200737-140200759 ATCCTAGCAATGCCACTCATGGG - Intergenic
1200431221 Y:3084951-3084973 GACCTAGCAATTCAATTAATGGG - Intergenic
1200543625 Y:4491610-4491632 AACCTAGTATTGCAATTAATTGG - Intergenic
1200726796 Y:6680761-6680783 TACCCAGCAATGAGATTGATGGG + Intergenic
1200727948 Y:6696537-6696559 TACCCAGCAATGAGATTGATGGG + Intergenic
1200782525 Y:7229507-7229529 AACCCACCAATCCTATTGCTGGG - Intergenic
1200826347 Y:7647661-7647683 CACCCAGCAATCCTATTGCTCGG + Intergenic