ID: 1053307658

View in Genome Browser
Species Human (GRCh38)
Location 9:36995548-36995570
Sequence CTGTGAGAATGGAGGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 2, 2: 5, 3: 62, 4: 674}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053307658 Original CRISPR CTGTGAGAATGGAGGAAAGG AGG Intronic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900359890 1:2283386-2283408 CTGTGAAAATGGGGGTGAGGAGG + Intronic
900391660 1:2436414-2436436 GAGGGAGAAAGGAGGAAAGGTGG - Intronic
901639728 1:10687149-10687171 GTGTGAGAATGGGGGACTGGAGG - Intronic
901666431 1:10828771-10828793 GTGTGAGGATGAAGGAATGGAGG + Intergenic
901802915 1:11719561-11719583 CTGGGCGAGTGGAGGCAAGGGGG - Intronic
902139129 1:14337539-14337561 CAGGAACAATGGAGGAAAGGAGG - Intergenic
902662475 1:17914729-17914751 CTATGACAAAGGAGGACAGGAGG - Intergenic
902974940 1:20081670-20081692 GTGTGAGAGTGAGGGAAAGGTGG + Intronic
903696705 1:25212781-25212803 CTGTAAGAAGGGAGGAAATGAGG - Intergenic
903759052 1:25685030-25685052 CTAAGAGACTGGATGAAAGGAGG + Intronic
904307599 1:29600144-29600166 CTGTGGGAAAGGAGAAAATGGGG + Intergenic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905688289 1:39924689-39924711 CTGGGAGAATGGGTGGAAGGAGG + Intergenic
905921528 1:41722512-41722534 GGGAGAGAAGGGAGGAAAGGAGG - Intronic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906199612 1:43950998-43951020 TTTTGTGAATGGAGGAAAGTAGG + Intronic
906227309 1:44132554-44132576 GTGAGAAAATGGAAGAAAGGCGG - Intronic
906789721 1:48648212-48648234 CTGGGAGGATGGAGAAAATGGGG - Intronic
908037965 1:60076035-60076057 ATGTGACAATGGAGGCAAGAGGG + Intergenic
908705678 1:66951778-66951800 CTGTGAGAAATAAGGAAAGTGGG - Intronic
908799417 1:67864162-67864184 CTGTGAGAATGGGGGTTGGGAGG + Intergenic
909425567 1:75520588-75520610 GGGTAAGAAGGGAGGAAAGGAGG + Intronic
909487093 1:76186432-76186454 CTATGAGAATGGAATGAAGGAGG - Intronic
909541205 1:76793438-76793460 CTGGGAGAATGAATGAAGGGCGG + Intergenic
910205172 1:84742535-84742557 CTTTGAGGATGGAGGAAGGGTGG + Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910534275 1:88278790-88278812 CTGTGAAAATTGAGGAACTGAGG - Intergenic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
911299905 1:96159135-96159157 CTATGAAAATGGAGGAAAAATGG + Intergenic
911389975 1:97229442-97229464 CAGTTAGAATGGAAGAAAGATGG + Intronic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
912652648 1:111453086-111453108 TTGAGAGATTGGAGGAATGGAGG + Intronic
912872410 1:113321194-113321216 GTGTGAGAACAGAGAAAAGGGGG - Intergenic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913706516 1:121429716-121429738 CTGAGAGAATGGAGCAGAGCAGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915534199 1:156524948-156524970 CTGAAAGCAAGGAGGAAAGGAGG + Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
915923656 1:159998684-159998706 TTGTCAGAAAGGAGGAAAAGGGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917855986 1:179100235-179100257 CTGTCAAAATGGAGGAGAGCTGG + Exonic
918991081 1:191697436-191697458 GTGTGAGAGTGGAGGAAAACTGG + Intergenic
920177670 1:204113145-204113167 GTGTGAGGATGGAGGCAGGGCGG - Intronic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
922397399 1:225216493-225216515 CTGGGAGAATGGAACCAAGGTGG - Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
924032039 1:239895403-239895425 CTGTGAAAAGGCAGGAATGGAGG - Intronic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924467808 1:244314016-244314038 CTGTTAGAATGGAGGCATGTGGG - Intergenic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1063157304 10:3391563-3391585 ATGTTAGAAGGGAGGAAAGGAGG + Intergenic
1064131458 10:12713601-12713623 CAGGGAGAAAGGAAGAAAGGAGG + Intronic
1064262474 10:13797213-13797235 CTGGGAGTGTGGTGGAAAGGCGG - Intronic
1064410238 10:15098156-15098178 CGGTGAGAAACTAGGAAAGGTGG - Intronic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1066203060 10:33160349-33160371 CAGTGAGAATGTAGGGAATGTGG - Intergenic
1066412569 10:35187856-35187878 CTGAGAGAATGGAGAAAACCAGG + Intronic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067151974 10:43743331-43743353 CGGGGAGAATTGAGGAAAAGAGG - Intergenic
1068288968 10:54976940-54976962 CTGTGAGGCTGGAAGAAAGGTGG + Intronic
1068475332 10:57516712-57516734 ATGTGAGAATAGAGGAAAAACGG + Intergenic
1068962163 10:62877717-62877739 ATGCGAGAAAGGAGAAAAGGAGG - Intronic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1070245382 10:74726362-74726384 CTGGGAGAATGGGAGAAATGAGG + Intergenic
1070690319 10:78520090-78520112 CTGTTACAATGGAGGAAATGTGG + Intergenic
1071087197 10:81876750-81876772 CTGGGAGACTTGGGGAAAGGAGG + Intronic
1071385268 10:85113238-85113260 CTGTGAGGTTGTGGGAAAGGAGG - Intergenic
1071729091 10:88230178-88230200 CTGTTAGAAATGAGGAAGGGAGG + Intergenic
1071847166 10:89532814-89532836 CTATGAATATGGAGGAAAGTGGG + Intronic
1072239441 10:93481739-93481761 CTGTGAGAAATGGGTAAAGGAGG - Intronic
1072519043 10:96214214-96214236 CTGTGAGAATGCTGGAGAGCAGG + Intronic
1072756760 10:98026671-98026693 CTGTGAGCATGAGGGAGAGGAGG + Intronic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073808634 10:107127808-107127830 CTGAGAGAATGGAGTGAATGTGG + Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074101137 10:110355693-110355715 CTGTTACAATAGAGAAAAGGAGG + Intergenic
1075474031 10:122717816-122717838 CTGGGGTAATGGAGGTAAGGCGG - Intergenic
1075902219 10:126052117-126052139 CTGTGAGGATGGAGCACAGGAGG - Intronic
1076586207 10:131549319-131549341 GTGTGAGGATGGAGGGAACGGGG + Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077804647 11:5578507-5578529 CTCTGGGACTGGAGGAAATGAGG + Intronic
1078403410 11:11047175-11047197 TTATGAGAATGGAGAAGAGGGGG + Intergenic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1079864408 11:25717053-25717075 CTGGAAGATGGGAGGAAAGGAGG - Intergenic
1080262267 11:30362187-30362209 TTGTGTGAATGAAGGAGAGGTGG - Intergenic
1081000381 11:37662935-37662957 CTGTGAGAATCTAAGAAAAGAGG + Intergenic
1081367842 11:42258311-42258333 CTGTGAAAATTGAATAAAGGAGG + Intergenic
1081542716 11:44047957-44047979 CATTGACAATGGAGCAAAGGAGG - Intergenic
1081726579 11:45333971-45333993 CTGTTAGCATGAAAGAAAGGGGG + Intergenic
1081963372 11:47154524-47154546 CTGTGAACATGGATGCAAGGAGG + Intronic
1082758812 11:57106197-57106219 CTGTAAAAAGGGAGGAAAGGGGG + Intergenic
1082864407 11:57885590-57885612 CTGTGAGAAGGGTGGAGAAGAGG - Intergenic
1082886301 11:58086842-58086864 CTGGGAGAAGGGAGTAAATGGGG + Intronic
1083069548 11:59962537-59962559 CTGGGAGAAAGGAGGAGTGGAGG + Intergenic
1083392298 11:62362009-62362031 CTGTGATAATGGAGCAAATGTGG + Intronic
1084495624 11:69501500-69501522 ATGGGTGGATGGAGGAAAGGAGG + Intergenic
1084680042 11:70661798-70661820 CAGGCAGCATGGAGGAAAGGAGG + Exonic
1084715873 11:70873008-70873030 CTGTGAGAAAGGAAGAGCGGAGG + Intronic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085363339 11:75913362-75913384 CTGTGATAATGTAGGAGAGCAGG + Intronic
1085688970 11:78650432-78650454 ATATGAGAATAGAGGAAATGGGG - Intergenic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086340504 11:85843688-85843710 ATGTGAGAATGCTGGAAAGTAGG - Intergenic
1086561804 11:88177007-88177029 CTGTGTGAAAGGGAGAAAGGAGG + Intergenic
1086562285 11:88181578-88181600 CTGTGACAATAGAGCAAATGGGG + Intergenic
1087012950 11:93530543-93530565 CTGTGAGCATGAATGAAAGCAGG - Intronic
1087432364 11:98069965-98069987 CTGTGAAAAGGAAGAAAAGGGGG + Intergenic
1087612356 11:100449552-100449574 CTGTCAGAAAAGAGGAAAAGGGG + Intergenic
1088377115 11:109153200-109153222 AGCTGAGAATGGAGAAAAGGTGG + Intergenic
1089182578 11:116593268-116593290 CCGTGAGGATGGTAGAAAGGAGG + Intergenic
1089854178 11:121526976-121526998 GGGAGAAAATGGAGGAAAGGAGG - Intronic
1089895795 11:121929021-121929043 ATGTGAGTGTGGAGGAGAGGGGG + Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090961393 11:131560587-131560609 CTGGAAGAAAGGAGGAAGGGAGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092131111 12:6114032-6114054 CTGTGAGATGGGATGAAAGGAGG - Intronic
1092847420 12:12596642-12596664 CCCTGAGAAGGAAGGAAAGGGGG + Intergenic
1093073528 12:14732733-14732755 TTGAGAGGATGGAGGAAAGGAGG + Intergenic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1093128661 12:15362058-15362080 ATATGAGAATGGAGAGAAGGAGG - Intronic
1093223347 12:16449782-16449804 ATGGGAGAATGGAAGAATGGGGG - Intronic
1093280280 12:17185841-17185863 CTGTGATAATAGAGGACAGCTGG + Intergenic
1093344617 12:18025307-18025329 CAGGGAGAATGGAGCAAAGTTGG + Intergenic
1094088490 12:26621158-26621180 CTATGAGAATGGAGAAATAGGGG - Exonic
1094384572 12:29880183-29880205 TAGAGAAAATGGAGGAAAGGAGG + Intergenic
1094499242 12:31007878-31007900 CTGTGAGAATGAAGGAGCTGTGG - Intergenic
1095922066 12:47541615-47541637 CTGTGATACAGGAGGAAATGTGG + Intergenic
1096594012 12:52682799-52682821 CTGTGAGAAGGGAGAAATGCAGG + Intergenic
1096662095 12:53132121-53132143 GGGGGAGAAGGGAGGAAAGGTGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096717288 12:53499275-53499297 CTGTGGGGATGGAGGAACTGGGG - Intronic
1096886314 12:54722683-54722705 TTGGGAGAATGAATGAAAGGGGG - Intergenic
1097423865 12:59416752-59416774 TTCTGAGATTTGAGGAAAGGAGG - Intergenic
1097994496 12:65872741-65872763 CAGTGATAATGGAGGTAAGCTGG - Intronic
1099462297 12:82938362-82938384 CTGTGAGAAGTGAGGACTGGTGG + Intronic
1100125125 12:91415484-91415506 GTGTAAGAATGGAGGAAGGGTGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101240651 12:102834847-102834869 CTGAGAGGTTGGAGGAATGGAGG + Intergenic
1101251484 12:102939947-102939969 CTGAGAGGATGGAGGCAAGCAGG + Intronic
1101589074 12:106110503-106110525 ATGTGAGAATTGAGGAAAACTGG - Intronic
1101672886 12:106893105-106893127 CTGGGACAAAGGAAGAAAGGGGG + Intergenic
1102097347 12:110250967-110250989 CTGTGAGAGTGGAGAAATGTTGG - Intergenic
1102504862 12:113377671-113377693 CTGTGAGAAATCAGGACAGGCGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1103466312 12:121144656-121144678 GGGTGAGACTGGAGGAAGGGAGG + Intronic
1105646279 13:22321274-22321296 ATGTGAGAATGGAGGAGCAGAGG + Intergenic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1106386162 13:29288225-29288247 CTCTGGGAATGGAGGCAATGGGG + Intronic
1106546781 13:30737687-30737709 CTGTGACAATGGAGGGACAGAGG - Intronic
1106654938 13:31733170-31733192 CTGTCAGAACGAAGGAAATGAGG + Intergenic
1106891526 13:34251210-34251232 CAATGAGATGGGAGGAAAGGTGG + Intergenic
1107703295 13:43072056-43072078 CTGTGAGTATGCAGGAATGCGGG - Intronic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108976198 13:56446131-56446153 CTGTCAGAAGGTAGGAGAGGAGG - Intergenic
1110760854 13:79228868-79228890 CTGTGACAAAGGGGGAAAGATGG - Intergenic
1112109657 13:96282191-96282213 ATGTGAGAATGTTGGAATGGAGG + Intronic
1112135256 13:96571040-96571062 CTGTGAGAATGTAGTTCAGGAGG + Intronic
1112338903 13:98536900-98536922 CTGGGCGACTGGAGGACAGGCGG - Intronic
1112664043 13:101548123-101548145 CTGTTAGAATGTAGAAAAGAAGG + Intronic
1113787850 13:113012055-113012077 CAGTGTGAATGGTGGACAGGTGG + Intronic
1114532152 14:23402905-23402927 CGGGGTGAATGGAGGAAGGGAGG + Intronic
1114717082 14:24838361-24838383 CTGTGGAATTGGAGGAAATGTGG + Intronic
1115389736 14:32841615-32841637 CTGTGAGAATGGACTAAAATTGG - Intergenic
1116370531 14:44125067-44125089 CTTTGAAAATGGAGGAAGGAGGG - Intergenic
1116869907 14:50060993-50061015 CTGAGAGAAATGAGGAAAGGAGG - Intergenic
1116972041 14:51076351-51076373 ATGGAGGAATGGAGGAAAGGAGG - Intronic
1117869358 14:60183734-60183756 GTGTGAGAATGCAAGCAAGGAGG + Intergenic
1119712125 14:76829865-76829887 CTGTGAGTCTAGAGAAAAGGGGG + Intronic
1120372339 14:83652002-83652024 ATGTGATAATGGATGTAAGGTGG + Intergenic
1120450982 14:84666368-84666390 CTGGGAAAATGGTGGATAGGAGG - Intergenic
1120844589 14:89114811-89114833 CTGAGAGATTAGAGGAAACGTGG + Intergenic
1120909737 14:89655394-89655416 GAGAGAGAAGGGAGGAAAGGAGG - Intergenic
1120984345 14:90320639-90320661 TTGTGAGAAAGAAGGAAAAGAGG + Intronic
1121412351 14:93756772-93756794 CTGGGTGAATGGAGGATTGGGGG - Intronic
1121881623 14:97506160-97506182 CTCTGAGAATGGATGAAATAAGG + Intergenic
1122138585 14:99648713-99648735 CTGGGAGCATGGAGGACAAGAGG + Intronic
1122563688 14:102635943-102635965 CTGTCAGAAGGGAGGGAGGGAGG - Intronic
1122810375 14:104284776-104284798 CCGTGACAATGGTGGAAACGAGG - Intergenic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1124229282 15:27928705-27928727 CTTTGAAGATGGAGGAATGGAGG - Intronic
1125404971 15:39342487-39342509 CTGGAAGAGTGGAGGAAAAGGGG - Intergenic
1125936457 15:43640497-43640519 CTGTGAAGATAGAGCAAAGGAGG + Intronic
1125949225 15:43737009-43737031 CTGTGAGGATAGAGCAAAGGAGG + Intergenic
1126096718 15:45095484-45095506 CTTTGAGGATGGAGGCAAAGGGG + Exonic
1126491544 15:49242466-49242488 GTGTGAGAATAGAGGAACAGAGG + Intronic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1127316557 15:57800350-57800372 TTGTGAGGATGGAGAAAATGGGG - Intergenic
1127508850 15:59620603-59620625 CTGTAAGAGTACAGGAAAGGTGG - Exonic
1128198483 15:65782384-65782406 CTGAGAGAATGAACGAAAGAGGG - Intronic
1128675091 15:69602681-69602703 GGGTGAGGATGGAGGAAAAGGGG - Intergenic
1129257584 15:74342831-74342853 CTTTGGAAATGGAGGCAAGGAGG + Intronic
1129325408 15:74797971-74797993 CTGATAGAAAGGAGCAAAGGGGG - Intronic
1129710391 15:77817853-77817875 TTGTGAGAATGCAGGACCGGTGG - Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130086851 15:80784782-80784804 CTGGGAGCATGTTGGAAAGGTGG - Intronic
1130145919 15:81273581-81273603 CAGGGAGAATGAAGGAGAGGGGG - Intronic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131442498 15:92469530-92469552 CTGTGAGACAGCAGGAAAGGAGG + Intergenic
1131898216 15:97057524-97057546 CTGTGTTCATGTAGGAAAGGTGG - Intergenic
1132590181 16:723162-723184 CTGTGAGGGGAGAGGAAAGGAGG + Intronic
1132891439 16:2206777-2206799 CTGAGAGAAGTGAGGACAGGAGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1135011260 16:18881158-18881180 CTTTGAGAATGGTAGAATGGTGG - Intronic
1135318163 16:21468751-21468773 CTTTGAGAATGGTAGAATGGTGG - Intergenic
1135371056 16:21900546-21900568 CTTTGAGAATGGTAGAATGGTGG - Intergenic
1135403940 16:22184881-22184903 CAGTGAGAATGCGGGAGAGGCGG + Intronic
1135440730 16:22470169-22470191 CTTTGAGAATGGTAGAATGGTGG + Intergenic
1135603064 16:23799838-23799860 CGGTGAGATTGGAGGGAAAGGGG - Intergenic
1136314930 16:29448457-29448479 CTTTGAGAATGGTAGAATGGTGG - Intronic
1136328372 16:29550193-29550215 CTTTGAGAATGGTAGAATGGTGG - Intergenic
1136443057 16:30290215-30290237 CTTTGAGAATGGTAGAATGGTGG - Intergenic
1137031292 16:35526740-35526762 CTCTGAGAATAGAGGAGACGAGG + Intergenic
1137297582 16:47110932-47110954 CCGTGAGAATGGTGGAAAATTGG + Intronic
1138222112 16:55260723-55260745 CTGTGAGAAGGGAAGACAGTAGG - Intergenic
1138920278 16:61519430-61519452 CTGTGATAATGGGGCAAATGCGG - Intergenic
1139234202 16:65317470-65317492 CTGAAAGAATGAAGGAAAGCAGG - Intergenic
1139889785 16:70242631-70242653 CTTTGAGAATGGTAGAATGGTGG - Intergenic
1139917400 16:70437275-70437297 ACTTGAGAATGGAGGAAGGGAGG - Intronic
1140415572 16:74771778-74771800 CTGTGACCATGGGGGGAAGGGGG - Intronic
1140774089 16:78233972-78233994 CTTTGAGAATGGAAGAGAGCAGG - Intronic
1140907834 16:79424688-79424710 CTGTGAGACTGTTGGAAAGATGG + Intergenic
1141467401 16:84215344-84215366 TTGAGAGAGGGGAGGAAAGGGGG - Intergenic
1141725129 16:85782881-85782903 CAGGGAGAATGCAGGAAAGGAGG - Intronic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1142058102 16:88013278-88013300 CTGTGAGGACTGAGGAAATGAGG + Intronic
1142144417 16:88486989-88487011 CTGTGAGGGTGGAGGAAATCAGG - Intronic
1143448562 17:7022637-7022659 CTGTGTTAAGGGAGAAAAGGGGG - Intergenic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1144019149 17:11224464-11224486 CTCTGAGCATGGCGGAAAGTAGG + Intergenic
1144443826 17:15308530-15308552 CTGTGAGAATGGTAGTAATGGGG - Intronic
1145103801 17:20098285-20098307 CTGTGAGACATGAGAAAAGGAGG - Intronic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1146621165 17:34399004-34399026 CTGTGACAATGGGAGAAAAGGGG + Intergenic
1146794864 17:35773821-35773843 GTGTCAGAGTGGAGGAGAGGTGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1148463679 17:47851838-47851860 CTGGGAGAGGGGAGGAGAGGAGG - Intronic
1148552435 17:48558537-48558559 CTCTGAGAATGGAAGAAAAAAGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1149306776 17:55355602-55355624 TTGTGAGGATGGAGAAAATGAGG - Intergenic
1149423693 17:56534573-56534595 CTGTTAAAATGTTGGAAAGGAGG - Intergenic
1149588161 17:57807561-57807583 CTTTGAGAATGGAGGAAGGCTGG + Intergenic
1150260158 17:63782662-63782684 CTGTGGGAAAGGAGAAACGGGGG - Intronic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1150624991 17:66835751-66835773 CTGTGAGAAGGGTTGATAGGAGG + Intronic
1151057712 17:71052781-71052803 CTCAGAGAAGGGAGGATAGGTGG + Intergenic
1151476853 17:74349042-74349064 TTGTGGAAGTGGAGGAAAGGAGG + Intronic
1151939454 17:77283296-77283318 CTCTGAGGATGGGGGAAGGGAGG + Intronic
1152150784 17:78599670-78599692 CTGTGAGATTGGAGGTGGGGGGG - Intergenic
1152181601 17:78825597-78825619 CTGTGAGATGGGAGGAATGCAGG - Intronic
1152350569 17:79781943-79781965 CTGAGAGACAGGAAGAAAGGGGG - Intronic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1153466528 18:5394573-5394595 GTGAGAGAACAGAGGAAAGGAGG + Intronic
1153483476 18:5571772-5571794 ATTTGGGAATGGAGGAAGGGTGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155093788 18:22536376-22536398 CTGTGAGAATGCACCAAATGAGG - Intergenic
1155114397 18:22750324-22750346 CAGTGATAATGGAGGAAAATAGG - Intergenic
1155124905 18:22863910-22863932 CTTTGACAAAGGAGTAAAGGTGG - Intronic
1155148886 18:23106630-23106652 GAGTGAGAATGGAGCTAAGGTGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156813595 18:41281698-41281720 CTGTGAGACTGGAGCAAATTTGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157382524 18:47232446-47232468 ATGTGAGCATTGAGGATAGGGGG - Intronic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157574394 18:48733866-48733888 CTGAGAGACTGGGGGAAGGGAGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157994234 18:52535999-52536021 CACTGAGAATGGAAGAAAAGTGG + Intronic
1158538354 18:58328974-58328996 CCCTGAGCATGCAGGAAAGGGGG - Exonic
1158683825 18:59594750-59594772 CTATGAGTAGGGATGAAAGGCGG + Intronic
1158864678 18:61626875-61626897 CTGTTACAGTGGAGGAAAGTGGG + Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159507392 18:69354802-69354824 ATGTGGGAGTGGATGAAAGGAGG - Intergenic
1160088960 18:75808114-75808136 CTGGGAGACTGGTGGCAAGGTGG - Intergenic
1160144485 18:76352278-76352300 CTCTGAGAAGGCAGGAAAAGCGG + Intergenic
1162084779 19:8241964-8241986 CTGAGGGAAGGGAGGAAATGAGG - Intronic
1162550725 19:11356988-11357010 CTGGGAGAATGGATGCAAGCAGG + Intronic
1162551188 19:11359353-11359375 CTGAGAGAAATGGGGAAAGGAGG - Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1164232580 19:23303164-23303186 CATGGAGAATGGAGGAAAGCAGG - Intergenic
1164357967 19:27464373-27464395 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165706754 19:37981774-37981796 CCGTGAGTATTTAGGAAAGGAGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1167915008 19:52733782-52733804 TTGTGAGGATGGAGGAGAAGAGG - Intronic
1167921260 19:52785210-52785232 CTGTGAGAATGGAGCAGAAGAGG - Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
1168145557 19:54418646-54418668 CAGTGAGCAGGGAGGAGAGGGGG + Intronic
1168183694 19:54682633-54682655 CTGTGAGCAGGGAAGAAAAGAGG + Intronic
925001961 2:410208-410230 CAGTGAGAATGGTGGAGTGGAGG - Intergenic
926473119 2:13286251-13286273 CGGTGAAAAGGGAGGAAAAGTGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927856642 2:26531791-26531813 CTATTAGATTGAAGGAAAGGGGG + Intronic
928104592 2:28460359-28460381 CTGTGAGACTGCAGAACAGGTGG - Intronic
929486301 2:42357948-42357970 CTGTGAGAGTGAAGGAAGGGAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930195781 2:48508531-48508553 TTGTTGGAATGCAGGAAAGGGGG + Intronic
930516380 2:52412530-52412552 CTGTAAGATTGGAGGCAATGAGG - Intergenic
931246673 2:60498116-60498138 CTGGGAGAATGGAGGTGTGGAGG + Intronic
932215000 2:69960953-69960975 CTTTGAGAATGTGGTAAAGGTGG - Exonic
932243338 2:70175325-70175347 GTGGGAGGAGGGAGGAAAGGTGG - Intronic
932499881 2:72174047-72174069 CTGTGAGAAAAGGGGCAAGGTGG + Intergenic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
932974382 2:76579971-76579993 ATGGGAGAATGGAAGAAAGGAGG + Intergenic
933554372 2:83813445-83813467 CTGTGAGAAGGGATGGCAGGAGG - Intergenic
933683081 2:85120121-85120143 CTGTGAGAGTGCAACAAAGGAGG + Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG + Intronic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
935419175 2:102848931-102848953 TTGTGAGGAAGCAGGAAAGGGGG - Intergenic
935980887 2:108625686-108625708 CTGCAGGAAAGGAGGAAAGGAGG - Intronic
936271891 2:111055339-111055361 CAGTTAGAATGCAGGAAAGAGGG - Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936912272 2:117605110-117605132 GTGTAAGAATGGAGAGAAGGGGG + Intergenic
936953977 2:118006039-118006061 GTGGGAAAATGGAGCAAAGGGGG - Intronic
937065837 2:119016984-119017006 CTGTGAGAAAGGAGCCAGGGAGG - Intergenic
937290754 2:120780402-120780424 CAGTGTGAAAGGAGGAAGGGAGG + Intronic
937477136 2:122225827-122225849 CTGGCAGGATGGAGGAGAGGAGG - Intergenic
937477615 2:122229189-122229211 CTGGGAGGGTGGAGGAAGGGAGG + Intergenic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938745456 2:134273892-134273914 CTGTGTGATTGGTGGAAGGGTGG - Intronic
938986644 2:136583029-136583051 ATGTGATAATGGAGCACAGGTGG - Intergenic
939958014 2:148542792-148542814 CTGTGAGAATGAGACAAAGGAGG - Intergenic
940169198 2:150808441-150808463 TTCTAAGAATGGAGGAAAGTGGG + Intergenic
940600185 2:155848690-155848712 CTCTGAGGTTGGAGGCAAGGAGG + Intergenic
941095036 2:161229409-161229431 CTCTGAGAATGAAGGGATGGAGG + Intronic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941480553 2:166004455-166004477 CTGTGAGAATGGAAAAGAGGTGG - Intronic
941616966 2:167731658-167731680 CTGTGTGAATGAAGGAAACCAGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941851943 2:170191696-170191718 CTGGGAGATTGGGGGAAGGGTGG + Intronic
941934923 2:170974740-170974762 CTGTGAGCAGGAGGGAAAGGCGG + Intergenic
942360724 2:175168572-175168594 CGGTGTGAGGGGAGGAAAGGTGG + Intergenic
942409758 2:175696488-175696510 CTAAGAGAATGGAGGAAAGAAGG + Intergenic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
942777800 2:179605873-179605895 CTGTGAAAAGGAAGGAAAGTTGG - Intronic
942967502 2:181914845-181914867 CTTTCAGAATGGAGAGAAGGAGG + Intronic
944292840 2:198027346-198027368 CTGGGGGAATGGAGGAATTGGGG + Intronic
944657192 2:201887664-201887686 CTGGGAGAATGAAGGGCAGGAGG + Intronic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946345660 2:219108290-219108312 CTTAGAGAATTCAGGAAAGGAGG - Intronic
946680034 2:222203852-222203874 CTGTTAAAATGGAGGAAGAGTGG - Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
947835586 2:233172484-233172506 CAGTGAAAATGAAAGAAAGGGGG + Intronic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948335622 2:237204828-237204850 CAGTGACACTGGAGGACAGGTGG + Intergenic
948408361 2:237739953-237739975 TTGTGGGAATGGAGGAGGGGAGG + Intronic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
1168737101 20:149875-149897 CAGTGAGGATAGAGGATAGGAGG + Intergenic
1169788779 20:9387594-9387616 CTGTGAAAATGCAGGAAATAGGG + Intronic
1169880071 20:10337496-10337518 CTGAGAGGAAGGTGGAAAGGAGG - Intergenic
1170585113 20:17728520-17728542 CTGTGTGAGAGGAGGAATGGAGG - Intronic
1170823412 20:19773150-19773172 GTGTGAGCATGGAGGACTGGAGG - Intergenic
1170827972 20:19813007-19813029 TTCTGAGAATGGAGGAATTGAGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172332398 20:34084382-34084404 CTGTGAGAATAGAGGGACAGAGG + Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172763869 20:37340569-37340591 TTGTGAGAAAAGATGAAAGGAGG - Intergenic
1173162921 20:40665648-40665670 CTTTGAAGATGGAGGAAGGGAGG - Intergenic
1173381968 20:42553535-42553557 CTGTGAGAATGAAGTAAACATGG - Intronic
1174339430 20:49886731-49886753 CCCTGAGCAGGGAGGAAAGGCGG - Exonic
1175700342 20:61132268-61132290 GTGTGAGAAGGGAGGCAGGGAGG - Intergenic
1176132068 20:63500372-63500394 GTGTGAGGAGGAAGGAAAGGTGG + Intergenic
1176382698 21:6121121-6121143 CTGTGGGAACAGAGGACAGGTGG - Intronic
1176585833 21:8584476-8584498 ATGAGAGAAGGAAGGAAAGGAGG + Intergenic
1177558902 21:22725745-22725767 CTGTGAGAATGGACTAAGGCAGG + Intergenic
1177906853 21:26982178-26982200 CTGAGAAAATGGGGGAGAGGGGG + Intergenic
1178086615 21:29118727-29118749 AGATGAGTATGGAGGAAAGGAGG + Intronic
1179108939 21:38428446-38428468 ATGTGAGAATGGAGAACACGTGG - Intronic
1179168968 21:38957975-38957997 CTGTGGGCATGGAGTAAATGGGG + Intergenic
1179310139 21:40188136-40188158 ATGTGAGTCTGGAGGAATGGGGG - Intronic
1179340459 21:40503435-40503457 CTCTGATAATGCAGGAAAGCTGG - Intronic
1179530149 21:42012750-42012772 ATGTGAGAGTGGATTAAAGGAGG - Intergenic
1179624609 21:42641741-42641763 ATGTTAGAAAGCAGGAAAGGAGG + Intergenic
1179740771 21:43417118-43417140 CTGTGGGAACAGAGGACAGGTGG + Intronic
1180147589 21:45929954-45929976 CTGTCCGAGGGGAGGAAAGGGGG - Exonic
1180244305 21:46536496-46536518 GTGTGAGAATTGAGGAGATGTGG + Intronic
1180268641 22:10561375-10561397 ATGAGAGAAGGAAGGAAAGGAGG + Intergenic
1180990206 22:19931099-19931121 CTGAGAGAAGGGATGAGAGGTGG + Intronic
1181881339 22:25982688-25982710 CTTTGAAGATGGAGGCAAGGGGG - Intronic
1181976412 22:26733848-26733870 CTTTGATAATGGAGGAAGGAAGG - Intergenic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1182710231 22:32318017-32318039 CTGTGAGGATGAGTGAAAGGGGG - Intergenic
1182789952 22:32942989-32943011 CTGAGAGAATGGAACCAAGGTGG + Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183135101 22:35879590-35879612 CTGTGAGAAATGAGAACAGGAGG + Intronic
1183275487 22:36894493-36894515 CTGTGAGGTTGGAGGAAGAGAGG + Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183737218 22:39650744-39650766 CTGGGAGCAGGGAGGACAGGAGG + Intronic
1184920849 22:47604763-47604785 CTGTGAGGATGATGGACAGGAGG + Intergenic
1184956429 22:47889906-47889928 GTGTGAGAATGGAGGAATACAGG + Intergenic
949243484 3:1898016-1898038 TAGTGAGAATGTAGGAAAGAGGG + Intergenic
949275143 3:2270547-2270569 CTCTGAGAATGAAGGAAAGTAGG - Intronic
949343755 3:3057573-3057595 CTCTGAGAAAGAAGAAAAGGTGG - Exonic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
949926428 3:9045957-9045979 CAGTGAGAATGGAGGAGAAAGGG - Intronic
950210471 3:11119340-11119362 TTGAAAGAATGGAGCAAAGGAGG - Intergenic
950290864 3:11783244-11783266 CTGGGAGACTGGAGAAAAAGTGG - Intergenic
951338381 3:21454189-21454211 ATGGGAGAAAGGAGAAAAGGGGG + Intronic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
951808641 3:26675439-26675461 GAGTGAGAATGTAGGAAAAGCGG + Intronic
952131662 3:30371059-30371081 TTGGGAGAATGCAGGAAAGAGGG - Intergenic
952211356 3:31231924-31231946 CTGAGAGATTGGTGGCAAGGAGG - Intergenic
952689123 3:36183062-36183084 ATGTGATAATGGATTAAAGGTGG - Intergenic
952844215 3:37673416-37673438 GTGTGAGATTGGAGAAAGGGAGG + Intronic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953175740 3:40550541-40550563 AAGAGAGAAAGGAGGAAAGGAGG - Intronic
955102868 3:55869214-55869236 ATGTGAAAATGGAGGAAAAAGGG + Intronic
955485999 3:59435336-59435358 CTGTGAGATTTGAGGAAATGAGG + Intergenic
955905747 3:63805998-63806020 AGGTGAGTATGGAGGAAATGGGG - Intergenic
955914575 3:63893891-63893913 CTGTGAGAGTGAAAGCAAGGTGG + Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956456023 3:69421159-69421181 GTGTGAGGGTGGAGGAAAAGGGG - Intronic
956486883 3:69732209-69732231 CTGAGAGGATGAAGGAAGGGTGG + Intergenic
956687527 3:71844058-71844080 GTGAGAGAACAGAGGAAAGGAGG - Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
956924286 3:73966982-73967004 CTGTCAGAATAGATGAAAGCAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957664987 3:83216377-83216399 ACGTGAGAATGGAGAAAATGAGG + Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
958088388 3:88843164-88843186 CTGGAAGAGTGGAGGACAGGAGG + Intergenic
960335016 3:116406704-116406726 CTGTGTGCATGGAGAACAGGAGG - Intronic
961424973 3:126837976-126837998 CTGGGAGAATGAGGGAACGGAGG - Intronic
962200361 3:133396387-133396409 GTATGAGAAGGGAGGAAATGGGG - Exonic
963068970 3:141286859-141286881 CTGTGAGGATGAAGGAGAAGGGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966909977 3:184553834-184553856 CTCAGTGAATGAAGGAAAGGAGG + Intronic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
968284671 3:197501449-197501471 CTGTAATAATGCAGAAAAGGTGG + Intergenic
968797741 4:2719791-2719813 CTGTCAGAAGGAAGGAAGGGAGG - Intronic
968842480 4:3017620-3017642 TGCTGAGAATGGAGGAGAGGAGG - Intronic
969000401 4:3976176-3976198 CTGAGAAAATGCAGGGAAGGTGG - Intergenic
969594347 4:8140480-8140502 CGGGGAGCATGGGGGAAAGGGGG + Intronic
969675280 4:8611140-8611162 CTGTCAGAAAGGAGGAGTGGAGG - Intronic
969711052 4:8844132-8844154 CTGGGAGTAGGGAGAAAAGGTGG + Intergenic
970703435 4:18770866-18770888 CATTGAGAATGGACAAAAGGAGG + Intergenic
970831459 4:20345210-20345232 CTGTGAGAATAGAGGATATTGGG + Intronic
971103013 4:23489317-23489339 CCTTGAGAATGGAGTATAGGTGG - Intergenic
971761215 4:30767945-30767967 CTGTAATAATGAAGGATAGGAGG - Intronic
972097539 4:35366998-35367020 ATTTGAGGATGGAGGATAGGAGG - Intergenic
972619456 4:40732951-40732973 AGGTGAGAAAGGAGGTAAGGAGG - Intergenic
972774112 4:42225796-42225818 CTGGGACCAAGGAGGAAAGGAGG - Intergenic
973289812 4:48459919-48459941 GGGTCAGAATGGAGGTAAGGTGG - Intergenic
973605074 4:52578646-52578668 CTGGAGGAATGAAGGAAAGGAGG + Intergenic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
974390421 4:61259678-61259700 GTGTGAGAAAGGAGGAAAGCAGG + Intronic
974543791 4:63274825-63274847 CATTGAGAATGGAGGGAGGGAGG + Intergenic
975358989 4:73444576-73444598 TTCTGAGAATCCAGGAAAGGAGG - Intronic
975558323 4:75686383-75686405 CAGTGAGAACAGAGGAAATGGGG + Intronic
975680808 4:76874144-76874166 AAGGGAGAATCGAGGAAAGGAGG + Intergenic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976829236 4:89295188-89295210 GTGTGAGAATGGAAAAAAGGGGG - Intronic
977785683 4:101032042-101032064 ATGAGGGAATGGGGGAAAGGTGG + Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978379420 4:108111444-108111466 CTGCCTGAAGGGAGGAAAGGAGG + Intronic
978711947 4:111793594-111793616 CTGTGGGAATGGAAGAACAGAGG - Intergenic
978973857 4:114844512-114844534 GAGTGAGAATAGAAGAAAGGTGG - Intronic
979301418 4:119091826-119091848 CTGTGACAATGGCGGCAAGCAGG - Intergenic
979303459 4:119114680-119114702 CTGGGGAAATGGAGGAAAAGGGG - Intergenic
980536783 4:134135372-134135394 AAGTGAAAATGGAAGAAAGGGGG - Intergenic
981255450 4:142656208-142656230 GGGTGAGAATGGAGAAAAGTGGG - Intronic
981563040 4:146067692-146067714 CTGTGAGAAGGAAGGAGAGAAGG - Intergenic
981659057 4:147145165-147145187 ATGAGAGACTGAAGGAAAGGAGG + Intergenic
981755181 4:148135076-148135098 ATGTGAGAGGGAAGGAAAGGGGG + Intronic
981980719 4:150787780-150787802 GTGGGAGGATGGAGGAGAGGTGG - Intronic
983183684 4:164677428-164677450 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
984056319 4:174933623-174933645 CCTTGAGGATGGAGGAAAGGAGG - Intronic
984679746 4:182593714-182593736 GTGTGAGATGAGAGGAAAGGAGG - Intronic
984839472 4:184054648-184054670 CTGTTCCAATGGAGGAAAAGGGG - Intergenic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985894718 5:2741406-2741428 CTGTTAGAATGGAGGCAAGGAGG + Intergenic
986095828 5:4553410-4553432 CACTGAGAAGGGAGCAAAGGTGG - Intergenic
986765279 5:10920138-10920160 CAGGGAGAATGGAAGAAAAGTGG + Intergenic
986848051 5:11778836-11778858 CTTTAATAATGGAGGAAAGTGGG + Intronic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
989622005 5:43393653-43393675 TCTTAAGAATGGAGGAAAGGAGG - Intronic
990124798 5:52501047-52501069 ATGTGAGAATGGAGGCTGGGAGG + Intergenic
990282339 5:54264579-54264601 CTGAGAGAATAGAGGAGATGAGG - Intronic
990437458 5:55807916-55807938 CAGGGAGAATGGAAGAAAGTTGG - Intronic
990551905 5:56889933-56889955 CTGAAAGAATAGAGGAAATGAGG - Intronic
990901505 5:60755339-60755361 CTGTGACAGTGGAGGACAAGTGG - Intronic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
991618263 5:68518641-68518663 CTGTTAGAAGGAAAGAAAGGAGG - Intergenic
991673893 5:69074295-69074317 CTGTGAGAAGCCAGGAAATGAGG + Intergenic
992188047 5:74262991-74263013 AAGTGAGAAGGGAGGAAATGGGG - Intergenic
993382599 5:87224841-87224863 CTTTGAAAATGGAAGAATGGAGG + Intergenic
993425606 5:87760649-87760671 AGGTGAGAGAGGAGGAAAGGAGG - Intergenic
993683971 5:90915579-90915601 TTGTGAGATTGGTGGAAAGAGGG + Intronic
993765602 5:91853474-91853496 ATTTGAGAATGGAAGTAAGGAGG + Intergenic
993926407 5:93871907-93871929 CTATGGGAAAGGAGGAAGGGAGG + Intronic
994006772 5:94846497-94846519 ATGTGAAAATGGAGAATAGGAGG + Intronic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994767437 5:103936578-103936600 CTTTGACAATGGAGGAATGTGGG + Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996312625 5:122123796-122123818 CTCTGAGACTGGTGGAAAGAAGG + Intergenic
996629110 5:125606517-125606539 CTGTGACATTCGAGGACAGGAGG - Intergenic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
998465611 5:142341504-142341526 GGGTAAGAATGGAGGAAAGAGGG + Intergenic
998552807 5:143093794-143093816 CTCTGAGAAGAAAGGAAAGGGGG + Intronic
998937099 5:147240906-147240928 CAGTGAGAAAGGTGGAAAGTAGG + Intronic
999199402 5:149805192-149805214 CTGTGAGAATCCAGCAAAGTGGG - Intronic
999645317 5:153711836-153711858 CTAGGAGAATGGAGGAAAATGGG + Intronic
1000134888 5:158337519-158337541 CATTGAGAATGGACAAAAGGAGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002587372 5:180258136-180258158 CCCTGTGAATGGAAGAAAGGTGG + Intronic
1002723830 5:181282034-181282056 CTGTTAGACTGGTAGAAAGGTGG + Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1003663467 6:8087182-8087204 CTGAGAGAATGACGGGAAGGAGG + Intronic
1003760110 6:9170308-9170330 CACAGAGAATGGAGGACAGGAGG - Intergenic
1004818333 6:19336994-19337016 CAGGCAGAAAGGAGGAAAGGAGG + Intergenic
1005105754 6:22222751-22222773 CTGTGAGGATAGGGGAATGGGGG - Intergenic
1006765879 6:36506292-36506314 CTATGAAAATGGAGAAAAGGTGG + Intronic
1007181443 6:39932048-39932070 CTGTGAGGATTGCGGAAAGGGGG - Intronic
1007350106 6:41266278-41266300 TGGTGAGAGTGGAGGAAAGGGGG + Intergenic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008303895 6:49876878-49876900 CTGTCAGAAGGGAAGATAGGGGG + Intronic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008659638 6:53652629-53652651 ATTTGAATATGGAGGAAAGGGGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009197804 6:60708351-60708373 CTGTGAAAATGGCGGGAAAGAGG - Intergenic
1009338112 6:62519008-62519030 CCGTCAGAATGAAGGGAAGGAGG - Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1010515271 6:76765538-76765560 CTATGAGGATGGAAGAAAGTCGG + Intergenic
1011136077 6:84102443-84102465 CTATGAAGATGGAGGAAGGGAGG + Intergenic
1011528139 6:88289294-88289316 CTGTGAAAATTAAGGAGAGGTGG + Intergenic
1011701563 6:89960062-89960084 CTGTGAGCATGGTGGAGGGGCGG - Intronic
1011808453 6:91099907-91099929 CTGGGAGAAAAGAGCAAAGGTGG + Intergenic
1012134953 6:95544163-95544185 AGCTGAGAATGGAGGCAAGGAGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012284000 6:97366445-97366467 GTGTTAGAATGGGGGAAATGGGG + Intergenic
1012403432 6:98865309-98865331 GTCTGAGAATGAAGGAAAAGGGG - Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012768141 6:103395964-103395986 TAATGAGAATGGAGCAAAGGAGG - Intergenic
1013003509 6:106048546-106048568 TTGTGAAATTGTAGGAAAGGGGG - Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013471195 6:110467976-110467998 CTATGAGAAGTGAGGAATGGTGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013668719 6:112375295-112375317 GCTTTAGAATGGAGGAAAGGGGG + Intergenic
1015225525 6:130852893-130852915 CTGTGAAGAAGGAGTAAAGGGGG - Intronic
1015301130 6:131654023-131654045 ATGGGAGAATGGTGGAAGGGTGG + Intronic
1015602083 6:134920425-134920447 CTGTGTGAATAGGGGAATGGAGG + Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016569804 6:145498663-145498685 CAGGGAGAATGGAGAAAAGCAGG - Intergenic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018596659 6:165488457-165488479 CTGGGAAAATGGTGGATAGGAGG + Intronic
1019042899 6:169120995-169121017 TTGTGCTAATGGAGGAGAGGGGG - Intergenic
1019254680 7:41705-41727 CTGTGAGGCTAGAGGTAAGGTGG - Intergenic
1019608193 7:1920688-1920710 CAGTGAGAAGAGAGGACAGGAGG + Intronic
1021162666 7:17295985-17296007 CTGTGAGAATGTATAATAGGTGG - Intergenic
1021772253 7:24016658-24016680 CTAGGAGAAGGGAGGAATGGGGG + Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022278103 7:28876257-28876279 CTGAGAAAATGAACGAAAGGAGG + Intergenic
1023189122 7:37560367-37560389 CTGCTACAATGGGGGAAAGGTGG - Intergenic
1024939351 7:54746067-54746089 CAGTGAGACTGGAGGACGGGAGG - Intergenic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1027112346 7:75450287-75450309 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027112351 7:75450319-75450341 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027112356 7:75450351-75450373 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027284580 7:76634829-76634851 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284585 7:76634861-76634883 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284590 7:76634893-76634915 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284595 7:76634925-76634947 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284600 7:76634957-76634979 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027292350 7:76728276-76728298 TAGTGAGAATGAAGGTAAGGTGG + Intergenic
1027440637 7:78215704-78215726 CCATGGGAATGGAGGAAAAGGGG + Intronic
1027912467 7:84268694-84268716 ATGTCAGAATGGAAGCAAGGAGG + Intronic
1027944160 7:84723675-84723697 CTGTGATCATGGAGGAGAAGAGG - Intergenic
1028137260 7:87234987-87235009 CTGAGATAGGGGAGGAAAGGAGG - Intergenic
1028194807 7:87893885-87893907 CTGAAAGAAGGCAGGAAAGGGGG - Intronic
1028827747 7:95293346-95293368 GTGTTAGAATGGATGAAATGAGG - Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029099768 7:98119305-98119327 TAGTGAGAATCAAGGAAAGGAGG + Intronic
1029557550 7:101280802-101280824 CAGTGAACAGGGAGGAAAGGGGG + Intergenic
1030079588 7:105765832-105765854 CCTTGAGAAAGGAGGAAATGTGG - Intronic
1030601927 7:111602577-111602599 AAGAGAGAATGGAGGAATGGAGG + Intergenic
1031002283 7:116430181-116430203 CAGTTATAATGGAGGAAGGGTGG + Intronic
1031109332 7:117587112-117587134 CTGGGAGAAAGGATGACAGGAGG + Intronic
1031767000 7:125792469-125792491 CGGTGAGAATGGAGAAAAATTGG + Intergenic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1032022821 7:128419466-128419488 GTGGGAGAGTGGGGGAAAGGAGG + Intergenic
1032155808 7:129466795-129466817 CTTGGAGTATGGGGGAAAGGGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033499349 7:141932138-141932160 CTGTGAGAATGAAGGGGAAGGGG + Intronic
1034192355 7:149222175-149222197 CTGTGCACTTGGAGGAAAGGGGG + Intronic
1034697165 7:153064012-153064034 GTGTGAGAGTGGAGGCAATGTGG - Intergenic
1034884751 7:154790792-154790814 CTAAGAGAAGGGAGGAAAGGAGG + Intronic
1035700645 8:1637167-1637189 CTCTGGGAAAGGAGGATAGGAGG - Intronic
1035819405 8:2576379-2576401 CTGTGAGAAAGCATGAAAGACGG - Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035928152 8:3752119-3752141 TAGTTAGAATGGAGTAAAGGTGG - Intronic
1036053433 8:5225606-5225628 CTCCGAGAAGTGAGGAAAGGAGG - Intergenic
1036579640 8:10061999-10062021 GTGGGGGAAGGGAGGAAAGGAGG + Intronic
1037213638 8:16423099-16423121 CCTTAAGAATGGAGGAATGGAGG - Intronic
1037839244 8:22232267-22232289 CTGGAAGAATGGGGGAAAGGCGG - Exonic
1037908287 8:22728162-22728184 CTGGGAGGATGGGGGAGAGGTGG + Intronic
1038045382 8:23761554-23761576 CTATGACAGTGGAGGAATGGGGG + Intergenic
1038639930 8:29315681-29315703 CTTTAAGGGTGGAGGAAAGGAGG - Intergenic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1039783961 8:40816025-40816047 CTGTGATGCTGGAGGAAATGTGG - Intronic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1040106292 8:43544186-43544208 CTGAGAGAGGAGAGGAAAGGAGG - Intergenic
1040311223 8:46237860-46237882 CTGTGAGAATGCAGGAATGCTGG + Intergenic
1040728874 8:50418361-50418383 CTTAGAGATTGGAGGAAAAGAGG - Intronic
1041452227 8:58017536-58017558 CAGTGAGAGTGGAGGAATTGTGG + Intronic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041575728 8:59392718-59392740 CAGTGAGAATGCTGGAAAGAGGG - Intergenic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041716706 8:60939083-60939105 CTCTGAAAAGGCAGGAAAGGTGG - Intergenic
1042099138 8:65255418-65255440 CTGTGGGACTGGAGAAAAAGAGG - Intergenic
1042194747 8:66222508-66222530 CTGGGAGACTGGAGACAAGGAGG - Intergenic
1042389012 8:68211570-68211592 CTCTGTGAATTGAGGAAAGCAGG - Intronic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1043107890 8:76137837-76137859 CTGTGAGAATGCAGAAAGGACGG - Intergenic
1044297815 8:90548702-90548724 CGGAGAGGATGGAGGAGAGGTGG + Intergenic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1044905338 8:96994993-96995015 CTATGAGGATGGAGCAGAGGAGG + Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045198333 8:99952646-99952668 CTGTTACAATGGGGGTAAGGAGG + Intergenic
1045414540 8:101952976-101952998 CCGTGGGGATGAAGGAAAGGAGG - Intronic
1045485923 8:102631144-102631166 CTGTGAGGATGGGGGAGGGGTGG + Intergenic
1045716693 8:105055430-105055452 CTATCAGAATGGAGGATGGGAGG - Intronic
1046524963 8:115371866-115371888 CGGGGAGAATGGAAGAAAGTTGG + Intergenic
1046652496 8:116852647-116852669 CTTAGAAAAAGGAGGAAAGGAGG - Exonic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1047269531 8:123342786-123342808 GAGGGATAATGGAGGAAAGGAGG - Intronic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1047772301 8:128039248-128039270 GTGGGAGGAGGGAGGAAAGGGGG - Intergenic
1047893009 8:129333801-129333823 CAGTAAGAATGGAAGAAGGGAGG + Intergenic
1048149165 8:131876759-131876781 CCGTTAAAATGGAAGAAAGGTGG - Intergenic
1048662126 8:136616762-136616784 GTGTAAGAATGGAGAAAAGGTGG - Intergenic
1048683659 8:136876262-136876284 ATTTGAGAAAGGAGGATAGGAGG - Intergenic
1048989436 8:139752652-139752674 ATGAGTGAATGGAGGAATGGTGG - Intronic
1049004396 8:139845617-139845639 CGGGGAGCATGGAGGAAAGGAGG - Intronic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049198843 8:141330019-141330041 CTGTGAAAATGGAGGTATCGGGG + Intergenic
1049761859 8:144335401-144335423 CTGTCAGCATGCAGGAGAGGGGG - Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050368214 9:4892877-4892899 CAGCAAGAATGGAGGAAAAGAGG + Intergenic
1052427078 9:28319255-28319277 CTTTGAGAATGGAGGAGGAGAGG - Intronic
1052864678 9:33457731-33457753 CTGGGAGAATAGAGGAGAGCTGG + Intergenic
1053036337 9:34829772-34829794 CAGTAAAAATAGAGGAAAGGGGG + Intergenic
1053112687 9:35476528-35476550 TTTTGAGACTGAAGGAAAGGAGG - Intergenic
1053160088 9:35808108-35808130 CTGTCAGAGAGGAGGAAAGCAGG - Exonic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1054824459 9:69558727-69558749 CTGTGAGGGTGGAGGATGGGAGG - Intronic
1054902375 9:70382990-70383012 TGGTGAGGATGGAGGAAAGGGGG - Intergenic
1054934856 9:70676332-70676354 CTATGAGAATAGATGAATGGTGG + Intronic
1055145682 9:72931906-72931928 CTATGAGAGTGAAGGACAGGAGG - Intronic
1055206162 9:73733091-73733113 TTGTGAGTTTGGAGAAAAGGTGG - Intergenic
1055242547 9:74201587-74201609 GTGTAAGAATGCAGTAAAGGGGG - Intergenic
1055430822 9:76241602-76241624 ATGTGAGAAGGGAAGAAAGAAGG - Intronic
1055581927 9:77715041-77715063 ATGTGAGAAGGCAGGAAAGATGG + Intergenic
1055720606 9:79169106-79169128 ATGAGAGAAGGGAGGAAAAGAGG - Intergenic
1055928106 9:81531523-81531545 CTGTGAGGAGAGAGAAAAGGAGG + Intergenic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1057412006 9:94825119-94825141 GGGAGAGAATGGAGGAGAGGAGG + Intronic
1057693796 9:97309772-97309794 CTGTGGGAGTGGGGGAATGGGGG - Intronic
1057885108 9:98823848-98823870 GGGTGAGGATGGAGGCAAGGAGG + Intronic
1058553059 9:106136386-106136408 CTGTGAGAATGCATGGGAGGAGG - Intergenic
1058590231 9:106557729-106557751 CTCTGAGAATGGAGGCAGGGAGG - Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060291948 9:122311340-122311362 CAGTGAGAAGGGAGAAAGGGAGG - Intronic
1060664113 9:125422778-125422800 CTGTGAGAATTGGATAAAGGAGG + Intergenic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061219598 9:129242587-129242609 GGGTGAGAATGGAGGCAGGGAGG + Intergenic
1061412493 9:130429141-130429163 TGGTGAGAAAGGAGGAAAGGCGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1203615735 Un_KI270749v1:61995-62017 ATGAGAGAAGGAAGGAAAGGAGG + Intergenic
1185766764 X:2732096-2732118 CTGTAGGAAGGGAGGAACGGAGG - Intronic
1186155884 X:6726028-6726050 ATTTGAGAAGGGAGGAAAAGAGG - Intergenic
1186359864 X:8829576-8829598 GTGAGAGAAGGGAGGAAAGGAGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186632719 X:11367437-11367459 CTCTGAGATGGGAGGAAATGGGG + Intronic
1186753039 X:12641389-12641411 CTGAGAGCATGGAGGGGAGGGGG - Intronic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1188402960 X:29770297-29770319 ATATGGGAATGGAAGAAAGGAGG - Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189644670 X:43115058-43115080 CTCTCAGAATGTAGGAAAAGAGG + Intergenic
1190950506 X:55138892-55138914 GTGTGAGAATGGACTAAAAGAGG + Intronic
1191984985 X:66970002-66970024 CGGTGAGAATGGAACAAAGTTGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1193135461 X:77966625-77966647 CTGTGAGTAGAGAGGAAATGGGG + Intronic
1193620977 X:83752027-83752049 CTGGGAGAATGGAACAAAGTTGG + Intergenic
1194240645 X:91443052-91443074 CAATGAGAATGTAGAAAAGGTGG + Intergenic
1194589771 X:95785639-95785661 CTGTAAGAATGTATGAAAGCAGG + Intergenic
1195006469 X:100690419-100690441 CTAAGAGAATGGAGGGAGGGAGG + Intronic
1195468074 X:105203025-105203047 CTGTGAAACTGGAAGCAAGGGGG - Intronic
1195539632 X:106047924-106047946 CTGTGGGAATGGAAGTTAGGAGG - Intergenic
1195605382 X:106800727-106800749 CTTTACGAATGAAGGAAAGGAGG - Intergenic
1195883022 X:109612374-109612396 CTAGGAGAGTGGAGGCAAGGTGG - Intergenic
1196830093 X:119768979-119769001 TTGTCAGAATGAAGGGAAGGAGG - Intergenic
1196834243 X:119800077-119800099 GTGTGAGAATGGAGGAAGAAGGG - Intergenic
1197144082 X:123151587-123151609 CTGTGAGGAAGGAGTAATGGAGG + Intergenic
1198103351 X:133440588-133440610 ATGTGAGCAGGGAGGAAGGGGGG - Intergenic
1198152211 X:133922380-133922402 CTCTGAGAATGGAGGATGGAGGG + Intronic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1200302442 X:154991162-154991184 TTGAGAGAATGGTGGAAAAGAGG + Intronic
1201229927 Y:11854308-11854330 TTGGGGGAAAGGAGGAAAGGTGG - Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1201549264 Y:15202287-15202309 ATTTGAGAAGGGAGGAAAAGAGG - Intergenic