ID: 1053308614

View in Genome Browser
Species Human (GRCh38)
Location 9:37001446-37001468
Sequence CTGCGGTGCTGTGTTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053308614_1053308618 21 Left 1053308614 9:37001446-37001468 CCTGCAGCAACACAGCACCGCAG No data
Right 1053308618 9:37001490-37001512 GACATCTGCTCAGGAGCAGCAGG No data
1053308614_1053308617 12 Left 1053308614 9:37001446-37001468 CCTGCAGCAACACAGCACCGCAG No data
Right 1053308617 9:37001481-37001503 AAGACGTCTGACATCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053308614 Original CRISPR CTGCGGTGCTGTGTTGCTGC AGG (reversed) Intronic