ID: 1053311448

View in Genome Browser
Species Human (GRCh38)
Location 9:37023383-37023405
Sequence CTGGAGTCCATAGGAAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053311448_1053311459 26 Left 1053311448 9:37023383-37023405 CCTGTACTTCCTATGGACTCCAG 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1053311459 9:37023432-37023454 GGGGACTGACACAGAGACAGAGG No data
1053311448_1053311456 7 Left 1053311448 9:37023383-37023405 CCTGTACTTCCTATGGACTCCAG 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1053311456 9:37023413-37023435 AGGACTCATCCCGTGAAAGGGGG No data
1053311448_1053311455 6 Left 1053311448 9:37023383-37023405 CCTGTACTTCCTATGGACTCCAG 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1053311455 9:37023412-37023434 GAGGACTCATCCCGTGAAAGGGG No data
1053311448_1053311453 4 Left 1053311448 9:37023383-37023405 CCTGTACTTCCTATGGACTCCAG 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1053311453 9:37023410-37023432 GTGAGGACTCATCCCGTGAAAGG No data
1053311448_1053311454 5 Left 1053311448 9:37023383-37023405 CCTGTACTTCCTATGGACTCCAG 0: 1
1: 0
2: 2
3: 11
4: 125
Right 1053311454 9:37023411-37023433 TGAGGACTCATCCCGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053311448 Original CRISPR CTGGAGTCCATAGGAAGTAC AGG (reversed) Intronic
902452368 1:16505183-16505205 CTGGAATCCATAGAAAGCCCAGG + Intergenic
904592407 1:31622352-31622374 CTACATTCCACAGGAAGTACTGG + Intronic
907862632 1:58368248-58368270 CTGGAATTCATAGGATTTACTGG + Intronic
909503505 1:76362053-76362075 CTGGGTTCCATAGGCTGTACAGG + Intronic
912812403 1:112804097-112804119 CTGGACTCCAGAGCAGGTACAGG - Intergenic
913644935 1:120846992-120847014 CTGGAATCCATGGAAAGTCCAGG + Intergenic
914081792 1:144416573-144416595 CTGGAATCCATGGAAAGTCCAGG - Intergenic
914095652 1:144542763-144542785 CTGGAATCCATAGAAAGCCCGGG + Intergenic
914099311 1:144570282-144570304 CTGGAATCCATGGAAAGTCCAGG + Intergenic
914176700 1:145285085-145285107 CTGGAATCCATGGAAAGTCCAGG - Intergenic
914299675 1:146367386-146367408 CTGGAATCCATGGAAAGTCCAGG - Intergenic
914302868 1:146391206-146391228 CTGGAATCCATAGAAAGCCCGGG - Intergenic
914531427 1:148526564-148526586 CTGGAATCCATGGAAAGTCCAGG - Intergenic
914636965 1:149561176-149561198 CTGGAATCCATGGAAAGTCCAGG + Intergenic
918740529 1:188125354-188125376 TTTGAGTTAATAGGAAGTACTGG - Intergenic
920725987 1:208435705-208435727 CTGGATTCCATAAGAAGTTCAGG + Intergenic
921255714 1:213337508-213337530 CTGGAGGACACAGGAGGTACGGG + Intergenic
922891166 1:229062783-229062805 CTGCAGCCCATGGGAAGCACAGG - Intergenic
1073566659 10:104541153-104541175 ATGGGGGCCATAGGAAGTAGGGG - Intergenic
1073759132 10:106611773-106611795 CTAGAGCCCATGGGAAGTTCTGG - Intronic
1081617028 11:44597200-44597222 CTGGAGTCCAGAGGGAGTACAGG - Intronic
1083490735 11:63013608-63013630 CTAAAGCCCATAAGAAGTACAGG - Intronic
1087575207 11:99981361-99981383 CTGGTGTCCAAAGGCAGTAGAGG + Intronic
1087578631 11:100024085-100024107 GTGGAGTTTATAGGAATTACAGG - Intronic
1090041053 11:123291798-123291820 CTGCAGTTCATAGGAAATACAGG + Intergenic
1092424285 12:8361610-8361632 TTGGAGTCAATAACAAGTACAGG - Intergenic
1096534329 12:52261493-52261515 CTGGAGTCCTCAGGCAGTGCAGG + Intronic
1098048462 12:66427124-66427146 CTGTACTCCAAAGGGAGTACAGG + Intronic
1099051160 12:77783160-77783182 CTGGAATCTATAGCCAGTACTGG - Intergenic
1099585041 12:84504882-84504904 TTGGAGACCATAGGATGTATTGG + Intergenic
1101211905 12:102543235-102543257 CTGGAGTGCAGAGGAAGAATAGG - Intergenic
1101728103 12:107404621-107404643 CTGGAAGCCAGAGGAAGTCCCGG - Intronic
1102152106 12:110695892-110695914 CTGGAGTCCATGTGGAGCACAGG + Intronic
1103212033 12:119174302-119174324 CTGCAGTCCATAGAAGGTGCCGG - Intergenic
1106032639 13:26016844-26016866 CTGGAGCCCATAGAGAGGACTGG + Intronic
1107600382 13:42006554-42006576 CTGGAGTCCCTCTGAAGAACTGG - Intergenic
1115721265 14:36163358-36163380 CTGGATTCCATAGGAAATAAAGG - Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118305477 14:64651475-64651497 TTGAAAACCATAGGAAGTACTGG + Intergenic
1121943220 14:98093023-98093045 CTGGAGTCAATAGGATGGACAGG + Intergenic
1123128897 14:105969828-105969850 TTGAAGTCCACAGGAAGCACAGG - Intergenic
1124999081 15:34753061-34753083 CCTGAGTCCATAGGAGGTCCTGG - Exonic
1126462155 15:48925846-48925868 ATGGTGTCAATAGGAAGGACGGG + Intronic
1129244446 15:74271056-74271078 CTGGTTTCCCCAGGAAGTACTGG - Intronic
1129898957 15:79130767-79130789 CTGGAGCCCAGAGGATTTACTGG + Intergenic
1132176134 15:99716707-99716729 CTGGAGCCCATAGGAAGCAGTGG + Intronic
1135567675 16:23524400-23524422 CTTGGGACCAAAGGAAGTACGGG - Exonic
1137010724 16:35317178-35317200 CTGGAGACCAAAGGAAGGGCAGG - Intergenic
1138789120 16:59881499-59881521 CTGGATTCATTAGGAAGCACAGG + Intergenic
1146404123 17:32522745-32522767 ATGGAGTCCACAGGCAGCACTGG - Intronic
1146460539 17:33042759-33042781 GTGGAGTCCACAGGAAGCAGAGG + Intronic
1146812661 17:35916329-35916351 CTGGCCTCCATAGGAGGAACTGG + Intergenic
1147446801 17:40479667-40479689 CTGATGTCCAGAGGAAGTAAGGG - Exonic
1148291434 17:46454331-46454353 CTGAAGTCCATAGTAGGTGCTGG + Intergenic
1148313622 17:46672033-46672055 CTGAAGTCCATAGTAGGTGCTGG + Intronic
1151096284 17:71502981-71503003 GTGGAGTCCAAAGAAAGTTCGGG - Intergenic
1154431602 18:14312970-14312992 CTGGACTCCAGAGTATGTACGGG + Intergenic
1156014013 18:32527332-32527354 CTGGAGTGAAGAGGAAGTAAAGG + Intergenic
1157096991 18:44694710-44694732 CTGGCCTACAGAGGAAGTACTGG - Intronic
1157532390 18:48432366-48432388 CTGGAGTGCAGTGGAATTACAGG - Intergenic
1160535796 18:79590670-79590692 CTGGCATCCATAGGAAGAAAGGG - Intergenic
1161150286 19:2703981-2704003 CTGGAGTCCAGAGGATGAGCAGG - Intergenic
1163845612 19:19636788-19636810 CTGGAGTCCCTAGGTGGCACAGG + Exonic
1163935709 19:20441317-20441339 CTGCATTCCATAGGATGTAAAGG + Intergenic
1165249847 19:34521146-34521168 CTGGAGGCCACAGGAACAACTGG + Intergenic
1166594204 19:44030723-44030745 CTGGGGTCCAGAGTAATTACTGG + Intronic
925185647 2:1844455-1844477 CTGGGGTCCATAGCAAGTACTGG - Intronic
932452805 2:71826289-71826311 CTGAAGTCCATAAGAAGAAAAGG + Intergenic
932649097 2:73536258-73536280 CTGGAGGCCTCAGAAAGTACTGG - Intronic
938294249 2:130167554-130167576 GTGGAGGCCATAGGAAGCAAAGG + Exonic
938315130 2:130319605-130319627 CTGGAGTCCTGAGGAAGGAGAGG - Intergenic
938462402 2:131506326-131506348 GTGGAGGCCATAGGAAGCAAAGG - Intergenic
939619308 2:144398971-144398993 ATGGAGTCCATAGGTTTTACAGG + Exonic
945382824 2:209161562-209161584 CTGGAGACCATAGCAAGCAGAGG - Intergenic
946859576 2:223988045-223988067 CTGGAGTCCAAAGGGAGTTCGGG + Intronic
947837139 2:233183953-233183975 ATGGAGTCCAGAGGAAGGAGTGG + Intronic
1170662662 20:18358233-18358255 CTGGAGACCAGAGGATGAACAGG + Intergenic
1173005171 20:39134680-39134702 CTGGAGTCTACAGGAATTTCTGG - Intergenic
1174693026 20:52528253-52528275 CTGGATTCAACTGGAAGTACTGG - Intergenic
1175818387 20:61895630-61895652 CTGGAATCCAGAGGAAGTGGGGG - Intronic
1184506673 22:44907917-44907939 CTGGAATCTCTGGGAAGTACAGG + Intronic
1184965826 22:47971460-47971482 TTGGTATCCATAGGAAGTCCTGG + Intergenic
951094655 3:18614670-18614692 CTGGAGACCATGCTAAGTACTGG + Intergenic
951980805 3:28564288-28564310 TTTCAGTCCATAGGAGGTACTGG - Intergenic
953924015 3:46971698-46971720 CTGGAGGCCTTAGGAATTTCAGG - Intronic
955360585 3:58270833-58270855 CAGTTGTCCATAGGAAGTCCAGG + Intronic
955956341 3:64293659-64293681 CTGAGGTCCATAGGCAGGACAGG - Intronic
957146217 3:76427297-76427319 CTGGAGACCATAGGAAGTGGGGG + Intronic
961097789 3:124172763-124172785 CTGCTGTCCACAGGAAGTAATGG + Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
962864352 3:139435016-139435038 CTGGAGGCCAGAGGGAGGACAGG - Intergenic
967972899 3:195012316-195012338 GAGGAGTCCAGAGGAAGTGCCGG - Intergenic
970418761 4:15884698-15884720 CTGCAGTCCATAGAGAGCACTGG + Intergenic
971171688 4:24240253-24240275 CAGAAGTCCTTAGGAAGTTCTGG + Intergenic
983085100 4:163433631-163433653 CTAATTTCCATAGGAAGTACAGG + Intergenic
987632032 5:20486093-20486115 CTGCAATCCATAGGATGTGCTGG + Intronic
990713905 5:58615046-58615068 GTGGTGTCCATGGGAGGTACTGG + Intronic
993835647 5:92817289-92817311 ATGGAGTACATAGGAGGTAGTGG - Intergenic
997919548 5:137965448-137965470 ATGGAGACCAGAGGAATTACCGG - Intronic
998251965 5:140559461-140559483 CTGGAGGCACTAGGAAGCACTGG - Intronic
998430556 5:142066258-142066280 CTGAAGGCAATAGGAAGCACTGG + Intergenic
999872348 5:155765617-155765639 CTGCATTCCAAAGGAAGTGCTGG + Intergenic
1000210639 5:159104002-159104024 CTGGAGTCCCCAGAAATTACTGG - Intergenic
1005169662 6:22968468-22968490 CTGGAATCCATAGAATGTTCTGG - Intergenic
1006786264 6:36669365-36669387 ATGGAGACCCTAGGAAGTGCTGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1017441237 6:154466263-154466285 CTGGAGCCCTTAGGATATACAGG - Intronic
1017559123 6:155607785-155607807 CTTGAGTCTATAGGAAGAAGAGG - Intergenic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1021601534 7:22369101-22369123 CTGGAGTCCATAGGTTTTACAGG + Intergenic
1022456544 7:30563276-30563298 CTGGAGTGCAGAGCAAGTATCGG + Intergenic
1022495374 7:30850010-30850032 CTGGAGTCAGTAGCACGTACAGG - Intronic
1024603568 7:51007689-51007711 CTGGAGTCCAGAGTCAGAACCGG + Intergenic
1029324520 7:99794573-99794595 CTGGAGTCCATAGAAAGCCCAGG - Intergenic
1032662795 7:134004266-134004288 ATGGCGTGCATAGTAAGTACTGG - Intronic
1034245180 7:149638651-149638673 CTGGAGTTCACAAGAAGCACAGG - Intergenic
1034350891 7:150414066-150414088 CTGGAGTACAGACGCAGTACAGG + Intergenic
1042727058 8:71889854-71889876 CAGGATTCCATAGGAAGAGCAGG + Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044706419 8:95013221-95013243 CTTGAGTAGCTAGGAAGTACAGG + Intronic
1048465076 8:134658876-134658898 CTGGAATCCATAGGAACTTTGGG + Intronic
1050800549 9:9607248-9607270 CTGGAGTCTATGGGGATTACTGG + Intronic
1053311448 9:37023383-37023405 CTGGAGTCCATAGGAAGTACAGG - Intronic
1056249440 9:84732985-84733007 CTGCAGTCCAGAGGCAGCACAGG - Intronic
1056832859 9:89930840-89930862 CTGGGGCCCATAGGAAGCAGAGG + Intergenic
1059189796 9:112314153-112314175 TTGGGGTCCTTGGGAAGTACTGG + Intronic
1061887488 9:133599120-133599142 CTGGAGCCCAGAGGCAGGACAGG - Intergenic
1203488815 Un_GL000224v1:84358-84380 CTGGAGTGCACAGTAAGAACTGG + Intergenic
1203501436 Un_KI270741v1:26253-26275 CTGGAGTGCACAGTAAGAACTGG + Intergenic
1185499463 X:585654-585676 CTGGAGTCCACAGTAATTGCAGG + Intergenic
1186246311 X:7620224-7620246 CTGGATTCCATAGAAACTAGTGG + Intergenic
1187410981 X:19050314-19050336 CAGGAGTGCAGAGGAAGTAATGG - Intronic
1189081718 X:37980290-37980312 CTGGATTCCCCACGAAGTACTGG + Intronic
1190022787 X:46894565-46894587 CTGCAGTGTATAGGATGTACAGG - Exonic
1195437425 X:104861517-104861539 CTTGACTCCATAGTAAGTAGAGG - Intronic
1198558168 X:137818574-137818596 CTGGAGTCCAGAGGAGGTCTTGG - Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic