ID: 1053314754

View in Genome Browser
Species Human (GRCh38)
Location 9:37041871-37041893
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053314754_1053314760 8 Left 1053314754 9:37041871-37041893 CCAACCACCCTCAGCCTGGAATG No data
Right 1053314760 9:37041902-37041924 GAACTTTACCAAATCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053314754 Original CRISPR CATTCCAGGCTGAGGGTGGT TGG (reversed) Intergenic
No off target data available for this crispr