ID: 1053315874

View in Genome Browser
Species Human (GRCh38)
Location 9:37051506-37051528
Sequence CAGTATCAGCTGCAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053315870_1053315874 -8 Left 1053315870 9:37051491-37051513 CCACCTGCTAATCATCAGTATCA No data
Right 1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG No data
1053315867_1053315874 25 Left 1053315867 9:37051458-37051480 CCTCAGTTTCTTCCTCTGTTAAC No data
Right 1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG No data
1053315869_1053315874 13 Left 1053315869 9:37051470-37051492 CCTCTGTTAACTGGATAGCATCC No data
Right 1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053315874 Original CRISPR CAGTATCAGCTGCAAGTGGA GGG Intergenic
No off target data available for this crispr