ID: 1053317731

View in Genome Browser
Species Human (GRCh38)
Location 9:37066441-37066463
Sequence AGGGAGTGGCTGTATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053317722_1053317731 10 Left 1053317722 9:37066408-37066430 CCTGTTAGTTACACCTAAAAGGG No data
Right 1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG No data
1053317720_1053317731 29 Left 1053317720 9:37066389-37066411 CCATTGCAGGGAGCATTCACCTG No data
Right 1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG No data
1053317727_1053317731 -3 Left 1053317727 9:37066421-37066443 CCTAAAAGGGCAAGGAAGGGAGG No data
Right 1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053317731 Original CRISPR AGGGAGTGGCTGTATGAAGA AGG Intergenic
No off target data available for this crispr