ID: 1053320345

View in Genome Browser
Species Human (GRCh38)
Location 9:37092846-37092868
Sequence GGCCTGTGGTTTCACAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053320345_1053320349 -2 Left 1053320345 9:37092846-37092868 CCACCACTGTGAAACCACAGGCC No data
Right 1053320349 9:37092867-37092889 CCCATATGCTAAAACAGCCCTGG No data
1053320345_1053320351 -1 Left 1053320345 9:37092846-37092868 CCACCACTGTGAAACCACAGGCC No data
Right 1053320351 9:37092868-37092890 CCATATGCTAAAACAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053320345 Original CRISPR GGCCTGTGGTTTCACAGTGG TGG (reversed) Intergenic
No off target data available for this crispr