ID: 1053320349

View in Genome Browser
Species Human (GRCh38)
Location 9:37092867-37092889
Sequence CCCATATGCTAAAACAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053320345_1053320349 -2 Left 1053320345 9:37092846-37092868 CCACCACTGTGAAACCACAGGCC No data
Right 1053320349 9:37092867-37092889 CCCATATGCTAAAACAGCCCTGG No data
1053320346_1053320349 -5 Left 1053320346 9:37092849-37092871 CCACTGTGAAACCACAGGCCCAT No data
Right 1053320349 9:37092867-37092889 CCCATATGCTAAAACAGCCCTGG No data
1053320343_1053320349 18 Left 1053320343 9:37092826-37092848 CCTTTAGGATATTGCTACAACCA No data
Right 1053320349 9:37092867-37092889 CCCATATGCTAAAACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053320349 Original CRISPR CCCATATGCTAAAACAGCCC TGG Intergenic
No off target data available for this crispr