ID: 1053322108

View in Genome Browser
Species Human (GRCh38)
Location 9:37107882-37107904
Sequence AGGGAGTGGCTGTATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053322099_1053322108 10 Left 1053322099 9:37107849-37107871 CCTTTTAGTTACACCTAAAAGGG No data
Right 1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG No data
1053322097_1053322108 29 Left 1053322097 9:37107830-37107852 CCATTGCAGGGAGCATTCACCTT No data
Right 1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG No data
1053322103_1053322108 -3 Left 1053322103 9:37107862-37107884 CCTAAAAGGGCCAGGAAGGAAGG No data
Right 1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053322108 Original CRISPR AGGGAGTGGCTGTATGAAGA AGG Intergenic
No off target data available for this crispr