ID: 1053325047

View in Genome Browser
Species Human (GRCh38)
Location 9:37136672-37136694
Sequence GACCAGCAACATGAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053325047_1053325051 28 Left 1053325047 9:37136672-37136694 CCATGTTGCTCATGTTGCTGGTC No data
Right 1053325051 9:37136723-37136745 ACCTCAGCCTCCCAAAGTGCTGG No data
1053325047_1053325053 29 Left 1053325047 9:37136672-37136694 CCATGTTGCTCATGTTGCTGGTC No data
Right 1053325053 9:37136724-37136746 CCTCAGCCTCCCAAAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053325047 Original CRISPR GACCAGCAACATGAGCAACA TGG (reversed) Intronic