ID: 1053325392

View in Genome Browser
Species Human (GRCh38)
Location 9:37142292-37142314
Sequence CAACCATGAGGTACAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053325392_1053325397 24 Left 1053325392 9:37142292-37142314 CCTTTGATTGTACCTCATGGTTG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1053325397 9:37142339-37142361 GCATATCTGTTAAGGACTTTGGG No data
1053325392_1053325396 23 Left 1053325392 9:37142292-37142314 CCTTTGATTGTACCTCATGGTTG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1053325396 9:37142338-37142360 TGCATATCTGTTAAGGACTTTGG No data
1053325392_1053325395 16 Left 1053325392 9:37142292-37142314 CCTTTGATTGTACCTCATGGTTG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1053325395 9:37142331-37142353 CTCTTTCTGCATATCTGTTAAGG No data
1053325392_1053325398 30 Left 1053325392 9:37142292-37142314 CCTTTGATTGTACCTCATGGTTG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1053325398 9:37142345-37142367 CTGTTAAGGACTTTGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053325392 Original CRISPR CAACCATGAGGTACAATCAA AGG (reversed) Intronic
903401328 1:23052620-23052642 AAAACATATGGTACAATCAATGG - Intronic
911872304 1:103114087-103114109 AAAGCTTTAGGTACAATCAATGG - Intergenic
915036188 1:152927384-152927406 AAACCATGATGTACAATACATGG + Intergenic
917255228 1:173108735-173108757 CAAGCAGGAGGTAAAATCTAAGG - Intergenic
919542002 1:198859060-198859082 TAGCCATAGGGTACAATCAACGG + Intergenic
919758402 1:201080673-201080695 GAGTCATCAGGTACAATCAATGG - Intronic
922861438 1:228820064-228820086 CAACTATGAGGTATTGTCAAAGG - Intergenic
923171161 1:231419049-231419071 CAGCCAAGAAGTACAATGAAAGG + Intronic
923741652 1:236660100-236660122 CCACCATGTGGTACAATGACAGG + Intergenic
1065785139 10:29205834-29205856 CAACCATCAGTGAAAATCAAAGG - Intergenic
1071353390 10:84768643-84768665 CAACCACCAGGTACTCTCAATGG - Intergenic
1074435445 10:113430387-113430409 CACCCATTAGGAACAGTCAATGG - Intergenic
1075037489 10:119081239-119081261 CAACCGTGAGAGACAATCATGGG + Intergenic
1077239906 11:1505120-1505142 CAGCCTTGAGTTCCAATCAAAGG - Intergenic
1085378948 11:76095072-76095094 GAACCGTCAGGTACAATTAAGGG - Intronic
1086164403 11:83760925-83760947 AGACAATGAGGTACATTCAAAGG - Intronic
1090870614 11:130743377-130743399 CAACCATGCAGTCCAATCAGAGG - Intergenic
1099902646 12:88731388-88731410 CAAGCATGTGGTATAATAAAAGG - Intergenic
1101570275 12:105947240-105947262 CTATCATGAGGTACATTCACAGG + Intergenic
1104221073 12:126785662-126785684 CAATTCTGAGCTACAATCAAAGG + Intergenic
1109369479 13:61403019-61403041 CAAACATGAAGTACAAAAAAAGG + Intergenic
1114769499 14:25412205-25412227 CAACAATGAAATACAATCAGTGG + Intergenic
1117218793 14:53580231-53580253 CAAGCCTAAGGTACAATAAAAGG + Intergenic
1121392848 14:93590678-93590700 AAACCATGATGGACAATGAAAGG + Intronic
1121510311 14:94507820-94507842 ATACCCTGAGGTACAATGAATGG - Intronic
1126097722 15:45101077-45101099 CTACCATGAGCTACTTTCAAAGG + Intronic
1127618658 15:60711765-60711787 AAACCTGGAGGTCCAATCAAAGG - Intronic
1128720824 15:69947184-69947206 CAACCATGACATACACTCACTGG - Intergenic
1130920784 15:88342802-88342824 CACCCATGAGGTAAAACGAAAGG - Intergenic
1135139740 16:19911365-19911387 CAAACATGAGGTAAAAACCAAGG - Intergenic
1137056079 16:35747271-35747293 CTACCAGGAGGAACAACCAAGGG - Intergenic
1138060272 16:53882949-53882971 CACCCATCAGGCACAATGAAGGG - Intronic
1141344339 16:83231384-83231406 CCATCAGGAAGTACAATCAAAGG - Intronic
1144560107 17:16314394-16314416 CAACCATTAAGTCCAATCACTGG + Intronic
1146741315 17:35286124-35286146 CAAACACAAGGTACATTCAAAGG - Intergenic
1146933716 17:36796679-36796701 CAACCAGGAGGTAAAACTAAGGG - Intergenic
1148545633 17:48516786-48516808 CAACAAAGAAGTAGAATCAATGG + Intergenic
1149680699 17:58505081-58505103 AAACCAAGAGGTACAACCCAGGG + Intronic
1150891141 17:69151541-69151563 CAACCATGTGTTACAAGTAATGG - Intronic
1152163753 17:78687153-78687175 TCACCATGATGTAGAATCAATGG + Intronic
1153342294 18:3988050-3988072 TCACCATAAGGTAGAATCAATGG + Intronic
1159032850 18:63248874-63248896 CAAGAATGAGGTACAATATAGGG - Intronic
1162254004 19:9472647-9472669 CTACCATAATGTAGAATCAATGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1167785708 19:51634529-51634551 CAACCATGAAGAACAATGAATGG + Intronic
1168516361 19:57013172-57013194 CATCCAGGAGGTACCATCCAGGG + Intergenic
929184561 2:39080120-39080142 TCACCATAATGTACAATCAATGG + Intronic
930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG + Intronic
933197952 2:79414229-79414251 CATCCCTGAGTTACAATCTAAGG + Intronic
934106541 2:88700140-88700162 CAACCTTGAGGTACAAGACAAGG - Intronic
938366447 2:130738271-130738293 CAACCATGGGGTACTAGCACAGG + Intergenic
939051995 2:137318444-137318466 CACCCAGGAGGTACAATATAGGG + Intronic
940111181 2:150155897-150155919 CAAACATGATGTTGAATCAAAGG + Intergenic
943627440 2:190216186-190216208 CAACAAGGAGGTGCAAGCAAAGG + Intronic
946233478 2:218307345-218307367 TCACCATAAGGTACAATCAATGG + Intronic
947041600 2:225927964-225927986 AAACAATGAGGTACAATCTGAGG + Intergenic
948097963 2:235351279-235351301 CAACGATGAAGTACAGTCAAGGG + Intergenic
949071299 2:242026228-242026250 CATCCATGAGGTTCCATCCACGG - Intergenic
1172185169 20:33027082-33027104 TAACCATGGTGTGCAATCAAAGG - Intergenic
1173079491 20:39852113-39852135 AAATCATGAGGTACAATAGATGG - Intergenic
1177171230 21:17658460-17658482 GAACATGGAGGTACAATCAATGG - Intergenic
1183135228 22:35880878-35880900 AAACCATGAGGTATTATAAAAGG + Intronic
1183565487 22:38611316-38611338 CTACTATGAGATACAATCTAGGG + Intronic
949158812 3:857039-857061 CATCCATGAGGTTCCATCCACGG + Intergenic
954470054 3:50686115-50686137 TCACCATGATGTAGAATCAATGG + Intronic
959066289 3:101660384-101660406 CAACTATGAGATAAAATCCAAGG - Intronic
963294198 3:143527621-143527643 CAACCAAGATTTACAAGCAATGG - Intronic
964045913 3:152326472-152326494 CAACAATGAGGTGAAATCATTGG - Intronic
964665727 3:159169832-159169854 CACCCAGGAACTACAATCAAAGG - Intronic
971504436 4:27350775-27350797 CAACAATGAGGCATAATCTATGG + Intergenic
972941391 4:44199035-44199057 CAATCATGAGGGACAAAGAAGGG + Intronic
976827841 4:89280494-89280516 CAACCATAAGGAAGGATCAATGG + Intronic
977526894 4:98157104-98157126 CCACCATGGGGTACAATTATGGG - Intergenic
987477260 5:18406412-18406434 CAACAATTATGTACAATCAGAGG - Intergenic
987770556 5:22297645-22297667 CAATTATGAAGTACATTCAATGG + Intronic
991107011 5:62855146-62855168 CAAACATGAAATACAAGCAAAGG - Intergenic
992471148 5:77056019-77056041 CAACTATGTTGTTCAATCAATGG - Intronic
994429813 5:99643855-99643877 CAACCATGAAGGACAGTCAAGGG + Intergenic
994829813 5:104765992-104766014 AAGCCAAGAGGTAAAATCAAGGG - Intergenic
997643574 5:135465794-135465816 CTACCATGGGGTACTATCATGGG + Intergenic
997773938 5:136581663-136581685 CAACCATGATTGAGAATCAATGG - Intergenic
997992490 5:138557098-138557120 CAAACATAAGGTATAAACAACGG + Intronic
998650186 5:144110267-144110289 TTACCATGAGGTCAAATCAATGG - Intergenic
1000461979 5:161534232-161534254 CATCCATTAGGTAGAAGCAAGGG + Intronic
1000737971 5:164929149-164929171 CCACAATGAGGTACAATCTCAGG - Intergenic
1002895875 6:1379836-1379858 CAACCTCGAGGTCCAACCAAGGG + Intergenic
1005754331 6:28911999-28912021 CAAGCTTGAGGTCCAATCATAGG - Intronic
1010170317 6:72967503-72967525 CAACCATATGATGCAATCAACGG + Intronic
1013447787 6:110248413-110248435 GGACCAGGAGGTACAATCCAAGG - Intronic
1014678626 6:124399744-124399766 CAAGTATTAGGTACAATTAATGG + Intronic
1016477179 6:144440590-144440612 CAACTGAGAAGTACAATCAAAGG - Intronic
1024458933 7:49639598-49639620 CAACCAGGAGGCTCAAACAAAGG - Intergenic
1027494750 7:78873577-78873599 CAACCATAATGTAGAATCAGTGG - Intronic
1030571905 7:111236799-111236821 CAATCAGCTGGTACAATCAAAGG + Intronic
1035161251 7:156951470-156951492 CAACCATGAGCTACATGCAAAGG - Intronic
1037068567 8:14614611-14614633 CAAAAATGAAGTAGAATCAAAGG - Intronic
1038674039 8:29607316-29607338 CAAGCATGAGGGCCAAACAATGG - Intergenic
1041332956 8:56748260-56748282 TCACCATAAGGTAGAATCAATGG - Intergenic
1041460089 8:58101803-58101825 GTACCAAGAGGTACAAACAATGG - Intronic
1042483319 8:69326877-69326899 CATCCATGAGGTTCCATCCACGG - Intergenic
1044731575 8:95232679-95232701 CAGCCATGAGCCACACTCAAAGG - Intergenic
1044912089 8:97070895-97070917 CACCAATGAGGTATAATCCATGG + Intronic
1046113266 8:109752413-109752435 AAACCATAAGGTACAATGACAGG - Intergenic
1047939300 8:129813462-129813484 CAACCAAGAAGTACAAAGAAGGG - Intergenic
1050172001 9:2829624-2829646 AAAGCATGAGGGAAAATCAAGGG + Intronic
1051051985 9:12945245-12945267 AAAAGATTAGGTACAATCAAAGG - Intergenic
1052033898 9:23658713-23658735 CCTCCATGAGGTATAAGCAAAGG + Intergenic
1053325392 9:37142292-37142314 CAACCATGAGGTACAATCAAAGG - Intronic
1054707792 9:68480352-68480374 GAACCATGAGGTTCCTTCAAGGG - Intronic
1055045394 9:71918804-71918826 CAACCATAATGTAGAATCATTGG - Intronic
1186173910 X:6905287-6905309 TAACCCTGAGGTGCACTCAATGG + Intergenic
1186633660 X:11378590-11378612 CAACCATGAGTTAGAAGGAATGG - Intronic
1186735474 X:12458763-12458785 AGACCATGAGGCACAATCAATGG + Intronic
1188249293 X:27873146-27873168 CAACCATGAGAAACAATACAGGG + Intergenic
1197122576 X:122909133-122909155 CACCCATGAGATCCAAACAAAGG + Intergenic