ID: 1053329498

View in Genome Browser
Species Human (GRCh38)
Location 9:37190210-37190232
Sequence CAGTGACAGCAGCAGCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 1, 2: 11, 3: 76, 4: 536}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053329498_1053329507 10 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329507 9:37190243-37190265 CATCTTGTTTGCTCAGGGGCTGG No data
1053329498_1053329510 19 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329510 9:37190252-37190274 TGCTCAGGGGCTGGGTATGGAGG No data
1053329498_1053329505 6 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329505 9:37190239-37190261 CCACCATCTTGTTTGCTCAGGGG No data
1053329498_1053329503 5 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329503 9:37190238-37190260 ACCACCATCTTGTTTGCTCAGGG No data
1053329498_1053329509 16 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329509 9:37190249-37190271 GTTTGCTCAGGGGCTGGGTATGG No data
1053329498_1053329508 11 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329508 9:37190244-37190266 ATCTTGTTTGCTCAGGGGCTGGG No data
1053329498_1053329502 4 Left 1053329498 9:37190210-37190232 CCCCACTGCTGCTGCTGTCACTG 0: 1
1: 1
2: 11
3: 76
4: 536
Right 1053329502 9:37190237-37190259 CACCACCATCTTGTTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053329498 Original CRISPR CAGTGACAGCAGCAGCAGTG GGG (reversed) Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902788805 1:18751108-18751130 CAGTGTAAACAGCTGCAGTGAGG + Intergenic
902798067 1:18812291-18812313 CACTGACAACAGCAGGGGTGGGG + Intergenic
903179579 1:21598412-21598434 CAGTGTCAGCACCACTAGTGGGG - Exonic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903372275 1:22844381-22844403 CAGAGACAGCAGCAGCACTCTGG - Intronic
903586784 1:24421957-24421979 CGGTGGCAGCAGCAGGAGTCAGG - Intronic
903779360 1:25811490-25811512 CAGTGAAAGCAGCAACATGGAGG + Exonic
903952843 1:27006091-27006113 CAGTGCCTGCAGCGCCAGTGCGG + Exonic
904413070 1:30336706-30336728 CAGGCCCGGCAGCAGCAGTGGGG + Intergenic
904715173 1:32462428-32462450 CAGAGAAAGCATCAGAAGTGAGG - Intergenic
904716354 1:32470693-32470715 CTGTGACTGCAGCATCATTGTGG + Exonic
904767776 1:32863646-32863668 GAGGGACAACTGCAGCAGTGGGG - Exonic
904945551 1:34196405-34196427 CATGTACAGCACCAGCAGTGGGG - Intronic
905020350 1:34806600-34806622 CAGTGACAGCATCATCAGATAGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905725860 1:40251529-40251551 CAGTCAGAGCAGCTGCAGTAGGG - Exonic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905858076 1:41328155-41328177 CACTGACAGCTGGAGCAGGGAGG + Intergenic
905872798 1:41414812-41414834 CAGGGACAGCACATGCAGTGTGG - Intergenic
906223919 1:44105482-44105504 GAGGGACAGAAACAGCAGTGTGG + Intergenic
906248169 1:44291721-44291743 CAGTTTCAGGCGCAGCAGTGTGG - Intronic
906258147 1:44366384-44366406 GTGAGACAGCAGCAGCACTGTGG - Intergenic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907524771 1:55047747-55047769 GGGTGGCAGCAGCAGAAGTGAGG + Intronic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
907834352 1:58094880-58094902 CAGTGTCAGCATCAGCTGAGTGG - Intronic
908070549 1:60455173-60455195 CAGTGACAGTGGCAGCAGGCAGG - Intergenic
908329386 1:63055703-63055725 CAGTGAGGGCATCAGCAATGGGG - Intergenic
909417769 1:75426835-75426857 CACTGATAGCAGCAGCGGTATGG + Intronic
910135776 1:83967505-83967527 CAGTGTCTGCAGCTGCACTGTGG + Intronic
911370520 1:96989464-96989486 CAGTCACAGCCCCAGCAGAGGGG + Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912634248 1:111277164-111277186 CAGTGGCAGAAGCAGATGTGAGG - Intergenic
912680551 1:111726422-111726444 CTGGGACTGGAGCAGCAGTGAGG - Exonic
912950311 1:114116242-114116264 CAGTGTCTGCTGCAGCAGTTTGG - Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
913233798 1:116763438-116763460 CAGTTAGAAAAGCAGCAGTGGGG - Intronic
913653992 1:120944390-120944412 CAGTGACAGTTGCAGAAATGAGG - Intergenic
913938453 1:125079549-125079571 CACTGACAGCTGCAGAAGTTGGG + Intergenic
913940215 1:125096363-125096385 CACTGACAGCTGCAGAAGTTGGG + Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914519676 1:148404485-148404507 CAGTGACAGTTGCAGAAATGAGG - Intergenic
914644184 1:149638554-149638576 CAGTGACAGTTGCAGAAATGAGG - Intergenic
914676516 1:149910716-149910738 AAGTGACAGCATCAGCAGAGAGG + Intronic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
916993701 1:170273056-170273078 CAGTGTCAGTAGTAGAAGTGGGG + Intergenic
917152656 1:171961311-171961333 CAGTGACAAGAGCAGCCATGAGG + Intronic
917402007 1:174660181-174660203 CAGGGACAGAAATAGCAGTGGGG + Intronic
917522600 1:175760560-175760582 CAGTGACAGGAGCATCATTGCGG - Intergenic
917717712 1:177754807-177754829 CAATGAGAGCAGCAGCACTGAGG - Intergenic
918094428 1:181322862-181322884 TAGTGACAGCAGCAGCTGAATGG + Intergenic
918270897 1:182898217-182898239 CAGTGGCAGCAACAGAAGGGAGG + Intergenic
919568896 1:199221660-199221682 AAGTCATAGCAGCAACAGTGAGG + Intergenic
920033673 1:203051993-203052015 CAATGACAGCTGCAGCCCTGGGG + Intronic
920823331 1:209401649-209401671 CAGTGTCAGCCGCTGCAGAGAGG + Intergenic
920976156 1:210787253-210787275 CAGGGACAGCAGTGGCTGTGGGG - Intronic
921417952 1:214912421-214912443 CAGAGACAGTGGCAGCAGTAAGG + Intergenic
921945694 1:220884563-220884585 TAGTAGCAGCAGCACCAGTGCGG + Exonic
922024681 1:221739495-221739517 CAGTGCCAGCTGCTGCACTGTGG - Exonic
922785398 1:228280053-228280075 CAGTGCCCACAGCAGCACTGAGG + Exonic
922821689 1:228489027-228489049 CAGAGTCAGCAGCTGCAGTGTGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
924942878 1:248824800-248824822 AGGTGGAAGCAGCAGCAGTGAGG - Exonic
1063149314 10:3322208-3322230 CAGAGGCAGGAGCAGCACTGGGG + Intergenic
1063177729 10:3567536-3567558 AGGTGACAACATCAGCAGTGAGG + Intergenic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065447391 10:25817338-25817360 CAGTTACAGGAGCTGCATTGGGG + Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066495414 10:35937575-35937597 AAGTGAGCCCAGCAGCAGTGTGG - Intergenic
1066688447 10:38003209-38003231 CAGTCACAGGAGCAGCACAGAGG - Intergenic
1067424555 10:46195505-46195527 AACTGACAGCAGCAGGAATGTGG - Intergenic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068345524 10:55773373-55773395 AACTGACAGCAGCAGGAATGTGG + Intergenic
1069694083 10:70374110-70374132 CAGTTACCACAGCAGCACTGGGG - Intronic
1070816653 10:79328653-79328675 CTGTGGCAGCAGCAGAGGTGGGG - Intergenic
1070860965 10:79660896-79660918 AACTGACAGCAGCAGGAATGTGG - Intergenic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1071795571 10:89001683-89001705 CATTGCCTGCAGCATCAGTGAGG - Intronic
1071982993 10:91022620-91022642 CAGTGGCAGATGCAGCTGTGCGG - Intergenic
1072206442 10:93209213-93209235 CAGTGAGATCATAAGCAGTGAGG - Intergenic
1072317861 10:94221245-94221267 CACTGACATCAGAAGCACTGGGG - Intronic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1072861297 10:99007807-99007829 CTGAGAAAGCAGGAGCAGTGAGG + Intronic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1074034658 10:109726101-109726123 CAGTGAGAGCAGAAGCTTTGAGG - Intergenic
1074134524 10:110615239-110615261 CTGTGCCAGCAGCAGCTCTGAGG + Intergenic
1075263407 10:120981461-120981483 CAGATACCGCAGCAGTAGTGTGG + Intergenic
1075299834 10:121312243-121312265 CAGTGACAGCAGCATCACCTGGG + Intergenic
1075651301 10:124129568-124129590 CAGAGGCAGCAGCTGCAGAGTGG - Intergenic
1075668318 10:124246097-124246119 CAGTGACATTCCCAGCAGTGAGG - Intergenic
1075893588 10:125975842-125975864 CAGTGACAGCACCAGCTGACAGG - Intronic
1076187834 10:128462696-128462718 CAGTGACAGCAGCACCTGGCAGG - Intergenic
1076921977 10:133459034-133459056 CAACGGCAGCAGCAGCTGTGAGG + Intergenic
1077158438 11:1101897-1101919 CAGTGCCAGCAGCAGCCGTCGGG - Intergenic
1077214120 11:1388290-1388312 CACTCACAGCAGCAGCAGCGGGG + Intergenic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1078457861 11:11489416-11489438 TAGTGTGAGCAGGAGCAGTGAGG + Intronic
1078510197 11:11979257-11979279 CAGATACAGCAGCAGCTGTCAGG - Intronic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1081164185 11:39786964-39786986 CTGTGGCACCAGCTGCAGTGGGG - Intergenic
1081489179 11:43554181-43554203 CAGTGGCAGCAGCAAAAGGGAGG - Intergenic
1081683679 11:45026526-45026548 CAGTCACAGCAGCAACACAGTGG + Intergenic
1081773299 11:45662811-45662833 GAGTCACAGCAGCAGCTGAGCGG + Intronic
1081856783 11:46308910-46308932 GAGTGACAGCAGCAGCAGCCAGG + Intronic
1083540828 11:63510596-63510618 CCGTGGCAACCGCAGCAGTGAGG - Intronic
1083902832 11:65652028-65652050 CAGTGATAGCAGTGACAGTGGGG + Intergenic
1084427588 11:69094121-69094143 CAGTGCCAGGGGCAGCAGTGGGG + Intergenic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085815757 11:79735499-79735521 CTGTGACAGCAGCAAGGGTGAGG - Intergenic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087188212 11:95225183-95225205 CACTGAGAGCAAAAGCAGTGGGG - Intronic
1087222582 11:95562478-95562500 CATTGACAGGAGATGCAGTGTGG + Intergenic
1087625769 11:100594529-100594551 CACACACAGCAGCAGCAGAGTGG - Intergenic
1087831679 11:102825926-102825948 CAGTGAAAGCAGCAAAAATGGGG - Intergenic
1088117529 11:106329404-106329426 CAGTGATGGAAGCAGAAGTGAGG + Intergenic
1088171518 11:107003110-107003132 TAGAGACAGCAGCACCTGTGAGG - Intronic
1088554223 11:111045297-111045319 GACTGACAGCAGAGGCAGTGGGG - Intergenic
1089816759 11:121182984-121183006 CAGTGGCAGCAGCTGCAGGCAGG + Intronic
1090763012 11:129853695-129853717 CTGTGACAGCAGCGGCTGTGTGG - Intronic
1090795141 11:130128955-130128977 CACTGACAGGAGAAGCACTGGGG + Intronic
1090987332 11:131780256-131780278 CAGGGACAGCAGGTGCAGAGAGG + Intronic
1091097694 11:132839621-132839643 CAGCGTCAACAACAGCAGTGTGG - Intronic
1091104852 11:132909044-132909066 CAGAGACAGAAGCATCAGTGCGG + Intronic
1091770604 12:3148826-3148848 CTGGGACAGCTGCAGCCGTGGGG - Intronic
1091846107 12:3657418-3657440 GCATGACAGCAGCAGCAGCGCGG + Intronic
1092211098 12:6646996-6647018 CAGAGGCAGGAGCAGCACTGCGG + Exonic
1092618606 12:10237917-10237939 GATTGACAGCAACAGCAGAGGGG - Intergenic
1092678712 12:10952824-10952846 ACATGCCAGCAGCAGCAGTGTGG - Intronic
1093113962 12:15186783-15186805 CAGTGACAGTTGCAGCACTGGGG + Intronic
1093518885 12:20024467-20024489 GAGTGGCAGCAGCAGCAGCAGGG + Intergenic
1094466895 12:30763018-30763040 CGGGGACAGAAGCAGGAGTGAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095262707 12:40115633-40115655 CAGTGGTAGCAGCAGCAGAAGGG + Intergenic
1098156621 12:67606155-67606177 CAGTGCTGGGAGCAGCAGTGAGG - Intergenic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098985980 12:77012825-77012847 CAGTGATTTCAGCATCAGTGTGG - Intergenic
1099072151 12:78058520-78058542 CAGTGACAGCAGCTGATATGAGG + Intronic
1100025413 12:90122144-90122166 CTGTGGAAGCATCAGCAGTGGGG + Intergenic
1100213777 12:92426621-92426643 CAGTGAGAGAAGCAAAAGTGGGG + Intronic
1101529033 12:105557704-105557726 CACTCAGAGCAGCAGGAGTGTGG - Intergenic
1101758483 12:107639996-107640018 GAGAGAGAGCAGCAGAAGTGGGG + Intronic
1102727969 12:115082184-115082206 CAATGAGGGCAGCAGCAGAGTGG + Intergenic
1102998149 12:117365191-117365213 CAGTGACAGCCACGTCAGTGAGG - Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103173535 12:118843151-118843173 CTGAGACACCAGCTGCAGTGGGG + Intergenic
1104535872 12:129617574-129617596 CATTGAAAGGAGCAGCAGTGCGG + Intronic
1104879472 12:132060517-132060539 ACTTGTCAGCAGCAGCAGTGAGG + Intronic
1105472773 13:20706896-20706918 GAGTGGCAGCTGCAGCAGGGTGG + Intronic
1106953214 13:34907434-34907456 CAGTGGCAGCACCATCACTGAGG - Intergenic
1108196157 13:47997559-47997581 CACTCCCAGCAGCAGCAGTGGGG - Intronic
1108701501 13:52948023-52948045 CAGAGACACCAGCAGGCGTGGGG + Intergenic
1109345737 13:61113269-61113291 CGGGGACAGCAGCTGCAGTGGGG + Intergenic
1110322402 13:74175053-74175075 CAGTGACAGTAGCAGCACCCGGG - Intergenic
1110401554 13:75097359-75097381 CTTTGACAGCAGCATCACTGAGG - Intergenic
1111711116 13:91815618-91815640 CATTGACAGCAGCTGGAGGGAGG - Intronic
1112294780 13:98177086-98177108 CGGAGAGAGCAGCAGCAGCGGGG - Exonic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114417709 14:22555465-22555487 CAGTGAGGGTAGCAGCAGAGGGG - Intergenic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1115923882 14:38409213-38409235 CAGAGGCAGCAGGATCAGTGTGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117175518 14:53142347-53142369 CAGTTAAACCAGCAGTAGTGGGG - Intronic
1117930741 14:60838574-60838596 CAAAGACACCAGCTGCAGTGGGG + Intronic
1118522143 14:66596897-66596919 CAATGACACCAGATGCAGTGGGG - Intronic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1122158359 14:99764701-99764723 CAGGCACAGAAGCAGCAGGGTGG + Intronic
1122172480 14:99888777-99888799 CAGAGACAAAAGCAGCCGTGGGG - Intronic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1123094464 14:105760213-105760235 AAGTGATAGCAGCAGCAGATAGG + Intergenic
1123124970 14:105940036-105940058 CAGGTACAGCTGCAGCAGTCAGG - Intergenic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123777065 15:23590558-23590580 CAGTGAGAGAAGCTGCAATGTGG + Intronic
1123802689 15:23838071-23838093 GTGTGACATTAGCAGCAGTGGGG + Intergenic
1124801621 15:32838493-32838515 CACAAACAGCAGCAGCCGTGGGG + Intronic
1124986370 15:34620064-34620086 CATTGACAGCAGCTGGAGGGAGG - Intergenic
1126790209 15:52214109-52214131 CAGTGACAGAAGCAGAAGGAGGG + Intronic
1126915557 15:53462235-53462257 CTGAGGCAGCAACAGCAGTGGGG - Intergenic
1127401059 15:58586335-58586357 CAGTCTCAGCGGCAGCAGGGAGG - Intergenic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127768442 15:62210535-62210557 CAGTGATAGCAGGAGCCATGGGG - Intergenic
1128684270 15:69672032-69672054 GAGGGGCAGCAGCAGGAGTGTGG + Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1130017977 15:80202018-80202040 CAGAGACAGCCACAGCAGTGGGG + Intergenic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130531451 15:84749807-84749829 CAGTGAAAGGGGCAGAAGTGTGG + Intronic
1130700577 15:86176422-86176444 CAGTGGCAGCAGCCCCAGTCAGG + Intronic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131188259 15:90293525-90293547 CAGAGTCTGCAGCAGCAGCGAGG + Intronic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132533090 16:463267-463289 CAGAGTCAGCAGGTGCAGTGAGG + Intronic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1132668935 16:1094890-1094912 CAGTGCTAGGAGCAGCAGGGCGG + Exonic
1132739229 16:1403061-1403083 CAGAGCCTGCAGCAGCAGGGAGG + Intronic
1132752446 16:1465016-1465038 CAGTGACAGCATGGGCAGCGAGG - Intronic
1132781919 16:1631594-1631616 CAGTGCCTGAAGCAGCACTGAGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1134121587 16:11587753-11587775 CAGTGATAACAGCAGCAGCCTGG + Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1135328147 16:21540774-21540796 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1135698039 16:24607440-24607462 CCGGGACAGAAGCAGCAGTGCGG - Intergenic
1135774752 16:25247201-25247223 TGGAGAGAGCAGCAGCAGTGGGG - Exonic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136338500 16:29626794-29626816 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1136567429 16:31078742-31078764 CAGTGACAGCATTGGCAGAGTGG - Exonic
1136858768 16:33681986-33682008 CAGGGGCCACAGCAGCAGTGAGG + Intergenic
1137545891 16:49403123-49403145 AAGGGACAGCTGCAGCAGAGGGG + Intergenic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1139244820 16:65431436-65431458 CAGTGACAGCAGCTATGGTGGGG - Intergenic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140460865 16:75138714-75138736 CAGAGCCAGCCGCAGCAGCGAGG + Intergenic
1141587939 16:85047596-85047618 CAGTGACAGTGCCAGCAGAGGGG - Intronic
1141671955 16:85496806-85496828 CAGTGACAGGAGCAGGTGAGGGG - Intergenic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1141746437 16:85929544-85929566 CAGTGACATGGGCAGCAATGTGG + Intergenic
1141809524 16:86365696-86365718 CTGTGGCAGCAGCTGCTGTGGGG + Intergenic
1141888197 16:86907722-86907744 CATTGACTGCATCAGCATTGAGG - Intergenic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1143411702 17:6713253-6713275 GAGTGGCAGCAGCAGGAGCGGGG + Exonic
1143527978 17:7483354-7483376 CAGAGCCAGCAGCTGCGGTGGGG + Exonic
1143722028 17:8819154-8819176 CTGTGACAGGAGCAGCAGGCAGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144773170 17:17770758-17770780 TAATGACAGCAGCAGCAACGGGG - Intronic
1145007102 17:19344216-19344238 AAGTGACAGCAGCTGAGGTGGGG + Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145305138 17:21669949-21669971 CAGTGACTGCAGCAGCGTGGTGG - Intergenic
1145314829 17:21723404-21723426 CAGAGGCGGCAGCAGGAGTGGGG - Intergenic
1146143535 17:30389221-30389243 AAGTGATAGCAGCAGCAGGCCGG - Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1152142493 17:78545038-78545060 GAGTGACAGAGGCAGCCGTGAGG - Intronic
1152227975 17:79101543-79101565 CAGTGACCCCAGCAGCCTTGTGG + Intronic
1152359077 17:79821994-79822016 CATTCACAGCCGCAGCAGTTTGG + Intergenic
1152517923 17:80837017-80837039 CTGTGGAAGCTGCAGCAGTGCGG + Intronic
1152603727 17:81278495-81278517 GAGTGCCATCAGCAGCAGTCAGG + Intronic
1152757118 17:82091670-82091692 CAGGGACAGCAGCACCTGCGGGG + Exonic
1152864325 17:82713140-82713162 TCATGACACCAGCAGCAGTGGGG - Intergenic
1153240764 18:3029522-3029544 CTGTGACAGCATCAGCTATGAGG - Intergenic
1154219517 18:12440100-12440122 CAGGTGCAGCAGCTGCAGTGAGG - Intergenic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1156019953 18:32588589-32588611 CAGTGACACCAGGAGCTATGGGG - Intergenic
1156424753 18:36997991-36998013 CAGTGACAGAAGCTTCAGTGTGG + Intronic
1160388401 18:78512103-78512125 CGGTGACAGCAGCTGCAGGTGGG - Intergenic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1160888540 19:1364280-1364302 CAGTGAAACCAGCAGCTGAGTGG - Intronic
1161283825 19:3458939-3458961 CAGTCAGGGCAGCAGCAATGGGG - Intronic
1161542385 19:4859862-4859884 CGCTGACAGCAGCCGCCGTGAGG + Exonic
1162705462 19:12551604-12551626 GAGTGACAGGAGAAGCAATGCGG + Intronic
1162790620 19:13060841-13060863 CAGTGGCGGCAGCAGCCGGGCGG - Intronic
1162967618 19:14163548-14163570 CCGTGACTGCAGCAGCAGGAGGG - Intronic
1163385144 19:16995344-16995366 CAATTGCAGCAGCAGGAGTGGGG - Intronic
1164711779 19:30362011-30362033 TAGGACCAGCAGCAGCAGTGAGG - Intronic
1164719759 19:30423778-30423800 CAGTGACAGCAGCTGTGGCGGGG + Intronic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165534475 19:36431803-36431825 TGCTGACAGCAGCAGCAGAGAGG + Intergenic
1165827970 19:38716433-38716455 CAGTGAAGACAGCGGCAGTGGGG + Intronic
1166772660 19:45293786-45293808 CAGTGATTGAAGCTGCAGTGGGG + Intronic
1167097149 19:47380578-47380600 CAGTGACAGGGGCAGAAGAGGGG + Intronic
1167473655 19:49688504-49688526 CAGTGCCAGCCTCAGCAGTGGGG + Intronic
1167488962 19:49780995-49781017 CAGGGACAGGAGAAGCAGAGAGG + Intronic
1167539468 19:50075846-50075868 CGTTGATAGCAGCAGCAGTGGGG - Intergenic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1167630243 19:50622011-50622033 CGTTGATAGCAGCAGCAGTGGGG + Exonic
1168162509 19:54521020-54521042 AATAGACATCAGCAGCAGTGAGG + Intergenic
1168714044 19:58516920-58516942 CGCTGTCAGCAGCAGCAGTGAGG + Exonic
925339491 2:3126297-3126319 AAGAGGCAGCAGGAGCAGTGTGG - Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929493465 2:42418368-42418390 CAGTGACAGTAGCTGAAATGTGG - Intronic
930283414 2:49398605-49398627 CACTGCCAGCAGCAGCAGCAGGG + Intergenic
932074014 2:68646305-68646327 AGGTGAGTGCAGCAGCAGTGGGG + Exonic
932880126 2:75493439-75493461 CAGCGACAGCAGCGACAGCGAGG - Exonic
933778415 2:85785638-85785660 CAGTGAGAGCAGCCTCTGTGTGG + Intronic
934569712 2:95361530-95361552 CAGTGACAGCAGGTGAACTGGGG - Intronic
934860550 2:97760814-97760836 CCGTGACTGCAGCAAAAGTGGGG + Exonic
934996564 2:98967135-98967157 CAGTGGCAGCAGCAGCACACTGG + Intergenic
935092080 2:99904984-99905006 CAGTGGTGGGAGCAGCAGTGGGG - Intronic
935338180 2:102036024-102036046 CAGTGACCACAGCAGCAGTTCGG + Intergenic
936147163 2:109987641-109987663 CGCTGTCAGCAGCAGCAGTGAGG + Intergenic
936197529 2:110383842-110383864 CGCTGTCAGCAGCAGCAGTGAGG - Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938319161 2:130351549-130351571 CCTGGTCAGCAGCAGCAGTGAGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938710848 2:133975263-133975285 CAGTGACACCTGCTCCAGTGGGG - Intergenic
939957506 2:148539345-148539367 CAGTGTCAGCTGGTGCAGTGTGG - Intergenic
940135905 2:150435769-150435791 CAGTGACGGCTGCAGCAGCTGGG - Intergenic
940362726 2:152813449-152813471 CCCTGGCAGCAGCAGCAGTCAGG + Intergenic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
940627888 2:156198790-156198812 CAGTGACAGCAGAATCACTTTGG - Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941889852 2:170568801-170568823 CAGTGACTGTAGCAGCAATCTGG + Intronic
942140085 2:172968710-172968732 CACTGACATAAGCAGGAGTGGGG + Intronic
942467524 2:176224362-176224384 CAGTCACAGAAGCAGAATTGAGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
944101947 2:196036642-196036664 CACTGGCAGCATCTGCAGTGGGG - Intronic
944341064 2:198600251-198600273 TAGTGACAGTGGCAGCAGAGGGG + Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947759993 2:232597176-232597198 CAGAGTCAACAGCATCAGTGAGG + Intergenic
948066709 2:235086648-235086670 AAGTGAAGGCAGCAGCAGAGGGG + Intergenic
948255296 2:236563960-236563982 CTGTGACAGCAGCTGGGGTGAGG + Intergenic
948431768 2:237923317-237923339 ACGTGACAGCAGGGGCAGTGGGG - Intergenic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
948594592 2:239071595-239071617 CAGTCACAGCAGTAGCAGGCTGG - Intronic
948884552 2:240876200-240876222 CAGGGACAGATGCAGCAATGGGG + Intronic
948999961 2:241607574-241607596 CAGGGACAGAAGCAGCTCTGTGG + Intronic
1168983546 20:2027471-2027493 CCATGACACCAGCTGCAGTGGGG - Intergenic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169130908 20:3166021-3166043 TAGTGGCGGCAGCAGCGGTGGGG - Exonic
1169197479 20:3691364-3691386 CAGAGGCAGCAGCCCCAGTGGGG + Exonic
1169258115 20:4114305-4114327 CTGTGACAGCCACAGCAATGGGG + Intergenic
1170644310 20:18183146-18183168 CTGTGACAGGAGCTGCAGTTTGG - Exonic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171424692 20:25042250-25042272 CAGTGGCAGCAGCCGCAGCCTGG + Intronic
1171482356 20:25463525-25463547 CAGTGACAGCGGCAGGAAAGTGG + Intronic
1171522653 20:25787423-25787445 CAGTGACTGCAGCAGCGTGGTGG - Intronic
1171530399 20:25849392-25849414 CAGTGACTGCAGCAGCGTGGTGG - Intronic
1171554174 20:26068460-26068482 CAGTGACTGCAGCAGCGTGGTGG + Intergenic
1171767954 20:29300584-29300606 CCGCGACTGCAGCGGCAGTGGGG - Intergenic
1173223998 20:41151245-41151267 CAGGGATAGCAGCTGCTGTGGGG + Intronic
1173250709 20:41362899-41362921 CAGGGACAGCAGGAGCCCTGGGG + Exonic
1173529327 20:43756566-43756588 CTGTGACTCCAGCTGCAGTGGGG + Intergenic
1174096065 20:48090556-48090578 CATTGAAAGCTGCAGCAGTAGGG - Intergenic
1174369452 20:50076776-50076798 CAGGGCCACCAGCAGCAATGAGG + Intergenic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1175241436 20:57552421-57552443 CAGTAACAGCATCAGAAGTAAGG - Intergenic
1175246567 20:57585857-57585879 CAGCGACAGCAGCAGCACCTGGG + Intergenic
1175401993 20:58706311-58706333 CACTGACACCACCAGCAGTGAGG - Intronic
1175657568 20:60784894-60784916 CACTGTCAGGAGCAGCTGTGGGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1177634914 21:23774692-23774714 CTGAGACAGCAGTAGCGGTGGGG - Intergenic
1178801210 21:35797561-35797583 CACAGGTAGCAGCAGCAGTGTGG - Intronic
1178893286 21:36538325-36538347 GAGTGACAGCAGCAAAACTGTGG - Intronic
1179075077 21:38113416-38113438 CAGTCACACCAGCAGCATTTTGG + Intronic
1179294530 21:40049369-40049391 GAGTCACAGCAGGAGCAGAGGGG - Intronic
1179409465 21:41151209-41151231 ATGTGACAGCTGCAGCAGTTAGG - Intergenic
1179889665 21:44329165-44329187 CAGAGCCAGCTGCAGCACTGGGG - Intronic
1180227145 21:46400978-46401000 CAGTGACAGCTGCTCCAGGGCGG + Intronic
1180820684 22:18825259-18825281 CAAGGGCATCAGCAGCAGTGAGG - Intergenic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181044405 22:20207769-20207791 CAGTGACACCACCTGCAGAGAGG + Intergenic
1181192289 22:21150788-21150810 CAAGGGCATCAGCAGCAGTGAGG + Intergenic
1181206907 22:21259731-21259753 CAAGGGCATCAGCAGCAGTGAGG - Intergenic
1181303875 22:21903074-21903096 CAGTGATAGCAGTGGCACTGGGG - Intergenic
1181670328 22:24422894-24422916 TAGTGGCAGAGGCAGCAGTGAGG + Intronic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1182866214 22:33606743-33606765 CCATGACAGCAGGGGCAGTGTGG - Intronic
1184288093 22:43483321-43483343 CAGTGACAGCTGGGGGAGTGGGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185071880 22:48661156-48661178 CAGTGACCCCAACTGCAGTGTGG - Intronic
1185340699 22:50289669-50289691 CAGAGACAGCCGGAGCAGTGGGG - Exonic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
1203220016 22_KI270731v1_random:35692-35714 CAAGGGCATCAGCAGCAGTGAGG + Intergenic
1203270810 22_KI270734v1_random:51134-51156 CAAGGGCATCAGCAGCAGTGAGG - Intergenic
949777100 3:7645689-7645711 CAGTGTTGGAAGCAGCAGTGTGG + Intronic
949852659 3:8434511-8434533 CAGTGCCACCTACAGCAGTGAGG - Intergenic
949934081 3:9102915-9102937 ATGTGACAGCAGCAGCAGGCGGG + Intronic
950365122 3:12477697-12477719 CAGGGACAGCAGTTGCAGGGTGG + Intergenic
951159587 3:19401195-19401217 CAGTGACACCAGCATCACTGTGG - Intronic
952735183 3:36682110-36682132 CTGTCACAACAGCAGCACTGAGG + Intergenic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
954293856 3:49663487-49663509 CAGACACAGCAGCAGCAGCAAGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954436666 3:50499944-50499966 CGGTGACAGCAGCAGCGGCTGGG + Intronic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
956406399 3:68932618-68932640 CAGGGACAGGAGCAGCCGGGCGG - Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
959530622 3:107431138-107431160 CAGTGGCAGCAGCAGAACCGGGG + Intergenic
960044959 3:113187625-113187647 CTGTCACAGCAGCTACAGTGGGG - Intergenic
960950130 3:122993793-122993815 TGCTGACAGCAGCAGCTGTGGGG - Intronic
961121427 3:124374519-124374541 CAGGGATAGAAGCAGAAGTGTGG + Intronic
961338407 3:126199945-126199967 GAGTTACAGCAGCCACAGTGGGG - Intergenic
961411067 3:126720755-126720777 AAGTGACAGCAGGAGCAACGTGG - Intronic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962927043 3:140004480-140004502 CATTCACAGGAGCAGCAGGGAGG + Intronic
963686943 3:148447636-148447658 TAGAGTCAGCAGCAGCAGTGTGG - Intergenic
963804896 3:149713739-149713761 CAGTGATAGCAGCAGCAGAGGGG + Intronic
964237160 3:154545192-154545214 CAGTGAGAGCTGCAGCCATGCGG + Intergenic
965205105 3:165712516-165712538 GAGTGCCAGCTGCAGCAGGGTGG + Intergenic
965367245 3:167815962-167815984 AATTGACAACAGCAGCAGAGAGG - Intronic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
967696048 3:192531761-192531783 CAGTGACAGCATCAAGCGTGTGG - Intronic
967956462 3:194881116-194881138 CATTTACTGCAGCAGTAGTGGGG - Intergenic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968310995 3:197682925-197682947 CAGGGACAGCATGAGCCGTGGGG - Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
969831461 4:9801005-9801027 CCATGACACCAGCAGAAGTGTGG + Intronic
970275092 4:14390865-14390887 CAGTGAAATCAGCTGCAGAGTGG + Intergenic
971119172 4:23684981-23685003 CAGGGACAGCATGAACAGTGGGG - Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971869721 4:32219057-32219079 GAGTGAAAGCAGAAGCAGTCAGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974460089 4:62176118-62176140 AACTGAAAGCAGCAGGAGTGGGG + Intergenic
975131872 4:70839510-70839532 CAGCGACTGCGGCAGCAGAGAGG + Exonic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
976140997 4:81991491-81991513 TAGAGGCAGCAGCAGCAGTGGGG + Intronic
976505249 4:85838680-85838702 CAGTTTCAGCAACAGAAGTGGGG - Intronic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
979828167 4:125266037-125266059 CAGTGGCGGCAGCAGCAGGTGGG + Intergenic
980215270 4:129844640-129844662 AAGTGACATCAGCTACAGTGTGG - Intergenic
980994195 4:139764881-139764903 CAGTCACTGAAGCAGGAGTGTGG - Intronic
981615456 4:146639365-146639387 CAGTGGCAGCAGCGGCGGCGGGG + Exonic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
982658893 4:158182778-158182800 CAGTGACAGCAGCTGCGTTCAGG - Intergenic
982901163 4:161003930-161003952 CAGTGATGCCAGCTGCAGTGGGG - Intergenic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
983609006 4:169621714-169621736 CAGTTACTGCAGCATCATTGTGG + Intronic
984818206 4:183857720-183857742 CAGGGACACCAGCAGCACTGGGG - Intronic
984862470 4:184253045-184253067 CACTGCCAGCCCCAGCAGTGAGG + Intergenic
985164623 4:187079341-187079363 CAGGCACAGCAGCAGCAGGCAGG + Intergenic
985209038 4:187572407-187572429 CAGTGACAGTCACAGCAGTTGGG + Intergenic
985516913 5:351436-351458 CACAGAGAGCTGCAGCAGTGTGG + Intronic
985710379 5:1424461-1424483 CAGTGACACCATGGGCAGTGAGG - Intronic
985723041 5:1500834-1500856 GTGTGAGAGCAGCAGCAATGAGG - Intronic
986241832 5:5967158-5967180 CAGTGAGAGCAGGATCACTGTGG + Intergenic
986284649 5:6350504-6350526 CAAGGACAGCAGCAGCAGCAAGG - Intergenic
987291581 5:16513339-16513361 GAGTTACAGCAGCCACAGTGGGG + Intronic
989165385 5:38428698-38428720 CAGTGGCAGCTCCAGCTGTGGGG + Intronic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989365680 5:40652840-40652862 CACAGACAGCAGCCACAGTGGGG - Intergenic
989624009 5:43412335-43412357 CACTGACAGCAACACAAGTGAGG + Exonic
990147310 5:52776451-52776473 AAGTTACAGCAGCAGGAGTTTGG - Intergenic
990903535 5:60779139-60779161 CAGTGAAAGCAGCAGGAAAGGGG - Intronic
992035874 5:72775548-72775570 CAGTGACATCAGCAAGATTGTGG + Intergenic
992332353 5:75730284-75730306 CAGTGCCTGCATCAGCAGAGTGG - Intergenic
992436420 5:76759753-76759775 GAGTGACAGCAGCAGGGGAGGGG + Intergenic
994384214 5:99110113-99110135 CATTGAGAGAAGCAGGAGTGTGG - Intergenic
996617131 5:125455595-125455617 TAGTGTCAGCAGCAGTGGTGGGG + Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998031680 5:138875536-138875558 CAGTGTAGGAAGCAGCAGTGAGG + Intronic
998367703 5:141641456-141641478 TAGGGACAGCAGCATCACTGGGG + Exonic
998499057 5:142616105-142616127 CAGTGCCTGTAGCAGCTGTGCGG + Intronic
998594273 5:143511959-143511981 CAGTGGCAGCAGCATCATTTAGG - Intergenic
998961410 5:147490862-147490884 CAGTCATGGCAGCAGCAGGGTGG + Intronic
999185030 5:149700868-149700890 CAGTGACGGCCACACCAGTGGGG - Intergenic
999315166 5:150579005-150579027 CAGGGACATCAGCTGCAGTCGGG + Intergenic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000113010 5:158127154-158127176 CAGGCACTGCAGCAGCTGTGCGG + Intergenic
1001064880 5:168528704-168528726 CAGGGACAGCGACAGCAGTTGGG - Intergenic
1001637047 5:173217896-173217918 CAGTGACTGGAGCTTCAGTGAGG + Intergenic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1003938745 6:11003120-11003142 AAGTGACAGCAGCAGCAGAAGGG - Intronic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004423422 6:15491358-15491380 CACTGACCGCAGCAGCAGATGGG - Intronic
1004984941 6:21070859-21070881 CAGTGTTGGCAGCAGCTGTGAGG + Intronic
1005555208 6:26972576-26972598 GAGTCACAGCAGCAGGATTGAGG + Intergenic
1005565745 6:27092225-27092247 CAGTGGCACCAGCAGCACTTGGG - Intergenic
1007764854 6:44154415-44154437 TGGGGACAGCAGCAGCAGTGGGG - Exonic
1008071832 6:47105984-47106006 CAGAGGCAGCAGCAACAATGAGG + Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008835253 6:55819741-55819763 CAGTGACAGCAGCTGAATTCCGG - Exonic
1009302497 6:62043303-62043325 CAGTGAAACCAGCAGCTTTGTGG + Intronic
1009525084 6:64733450-64733472 CACTGTCAGCAGCATCATTGTGG - Intronic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1013425204 6:110005597-110005619 CAATGACCACAGCAACAGTGAGG + Intergenic
1013650946 6:112193806-112193828 CATTTATAGCAGCAGCAGTGTGG - Intronic
1014494177 6:122100140-122100162 CGGAGCCAGCAGCAGCAATGTGG + Intergenic
1015804218 6:137092256-137092278 CAGTGACTGCTTCTGCAGTGTGG + Intergenic
1018025870 6:159805230-159805252 CAGCGAGAGCAACAGCATTGTGG + Intronic
1019281867 7:204679-204701 CACTGAGAACAGCGGCAGTGTGG - Intronic
1019281895 7:204821-204843 CACTGAGAACAGCGGCAGTGTGG - Intronic
1019527688 7:1488046-1488068 CAGAGGCAGCAGCAGCCGTAGGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021203711 7:17754060-17754082 CATTGCCAGCAGCAGTGGTGTGG - Intergenic
1021270168 7:18575030-18575052 CCATGACACCAGCTGCAGTGGGG - Intronic
1021314639 7:19132353-19132375 CAATGACAAGAGCAGCACTGAGG - Intergenic
1022459637 7:30593372-30593394 GAATGACTGAAGCAGCAGTGGGG + Intergenic
1023032028 7:36098288-36098310 CCATGACAGAAGCATCAGTGAGG - Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023529418 7:41137052-41137074 CAGGGACGCCAGCTGCAGTGGGG - Intergenic
1024296016 7:47842898-47842920 CAGTGTCAACATCAGAAGTGAGG - Intronic
1024306184 7:47931419-47931441 CAGAGACCTCAGTAGCAGTGGGG - Intronic
1024805109 7:53130313-53130335 CACTGACAGCTGCAGAAGTTGGG + Intergenic
1025283128 7:57642623-57642645 CAGTGACTGCAGCAGCGTGGTGG - Intergenic
1025860856 7:65326215-65326237 GAGTGACATCAGCAGGAATGTGG - Intergenic
1025973820 7:66353713-66353735 CACTGACAGCAGCAGCCTGGAGG - Intronic
1026408288 7:70091621-70091643 CAGTGACTGTAACAGCAGAGTGG - Intronic
1027516727 7:79151073-79151095 CAATAACAGAAGCAGCACTGAGG - Intronic
1028659533 7:93253605-93253627 AAGGCAGAGCAGCAGCAGTGGGG + Intronic
1029170595 7:98627045-98627067 CGGTGACAGGAGGAGCAGTGTGG + Intronic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029479709 7:100805138-100805160 CAGTGGCAGGAGCTGGAGTGGGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029956910 7:104649740-104649762 TAGTGAGAGCAGCAGGAGTAGGG + Intronic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032162676 7:129522793-129522815 CAAGGACAGCAGCAGCAGCGTGG + Intergenic
1032786952 7:135208538-135208560 CAGTGACAGTGGCAGCAGTGGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1034292568 7:149944711-149944733 CAGTGACAGAGAAAGCAGTGGGG - Intergenic
1034813502 7:154152181-154152203 CAGTGACAGAGAAAGCAGTGGGG + Intronic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1034972448 7:155427652-155427674 CAGTTATAGCAGCAGCACCGGGG + Intergenic
1035121323 7:156570279-156570301 CCGTGAGAAAAGCAGCAGTGGGG - Intergenic
1035316112 7:157998330-157998352 CAGAGCCAGGAGCAGCAGTCAGG + Intronic
1035732136 8:1860589-1860611 CAGTGACAGGAACACCACTGAGG + Intronic
1035983692 8:4401995-4402017 CAGTGGTAGCAGCAGGAATGTGG - Intronic
1036470971 8:9052488-9052510 CACTGACACCAGCAGCATTCTGG + Intronic
1036931061 8:12955863-12955885 CAATGACAGCAGCAACCCTGGGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037985429 8:23288156-23288178 CGGTGAGTGCAGCAGCACTGGGG + Exonic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1038852614 8:31294942-31294964 CTGTGACAGCAGCAGCACCTAGG + Intergenic
1039422641 8:37456313-37456335 AAGTGACAGCAACAGCAGAAAGG - Intergenic
1039447981 8:37647938-37647960 CAGGGCCAGCAGCAGCTCTGAGG - Intergenic
1039782182 8:40796662-40796684 CAGTCTCTGCAGCAGCTGTGCGG - Intronic
1039957267 8:42217252-42217274 CAGAGAAGGAAGCAGCAGTGGGG + Intergenic
1039987598 8:42460938-42460960 CGATGACAGCAGCAGAAGTATGG + Intronic
1040440663 8:47438229-47438251 CACTGACAGCAGCAGCTGTCAGG - Intronic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041798772 8:61775217-61775239 CACTGACCATAGCAGCAGTGAGG + Intergenic
1041869370 8:62615821-62615843 CCCTGGCAGCAGCAGCAGTGTGG - Intronic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042447481 8:68903349-68903371 CACTGACAACAGCAGTAGTCAGG + Intergenic
1042633254 8:70844319-70844341 CAATGGCAGCAGCAGCAGCAAGG - Intergenic
1042633352 8:70844857-70844879 GGGTGATGGCAGCAGCAGTGGGG - Intergenic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1043437812 8:80251715-80251737 CAGTGACAGCTCCACCAATGAGG + Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1047508542 8:125498455-125498477 CAGAGACAGCAGCTACAGGGTGG - Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1048315453 8:133358549-133358571 AGGGCACAGCAGCAGCAGTGAGG + Intergenic
1048332802 8:133482547-133482569 AAGTGAAAGCAGATGCAGTGGGG - Intronic
1048343116 8:133555771-133555793 CCGTTCCAACAGCAGCAGTGAGG - Intronic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1048877200 8:138846179-138846201 CCAGGACAGCAGCAGCTGTGGGG + Intronic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048968867 8:139633034-139633056 CAGGGACACGAGTAGCAGTGGGG + Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049180994 8:141222113-141222135 CCTGGACAGCACCAGCAGTGTGG - Intronic
1049415324 8:142492365-142492387 CAGGGACAGACGGAGCAGTGTGG + Intronic
1049587856 8:143440290-143440312 CAGCCACGGCAGCCGCAGTGAGG + Exonic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050046810 9:1554828-1554850 GAGTGACAGCACCAGATGTGAGG - Intergenic
1050880896 9:10699535-10699557 CTGTCAGATCAGCAGCAGTGGGG + Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051029779 9:12659203-12659225 CCATGACACCAGCTGCAGTGGGG - Intergenic
1051143487 9:14003137-14003159 CACTGACACCAGCAGCAGTGTGG - Intergenic
1051307124 9:15723060-15723082 CAGTGCCAGAGACAGCAGTGGGG + Intronic
1051363406 9:16302486-16302508 CAGTTTCTTCAGCAGCAGTGTGG + Intergenic
1051879957 9:21829747-21829769 CAGTGCCAGCATGAGCAGGGCGG + Intronic
1052552689 9:29970449-29970471 CCGTGACACCAACTGCAGTGTGG - Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1055080458 9:72263712-72263734 CAGTGACAGTAGCTGGAGTGGGG + Intergenic
1055231761 9:74074812-74074834 CACCAACAGCTGCAGCAGTGTGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056790021 9:89619213-89619235 CAGGGACTGCACCAGCAGGGAGG + Intergenic
1056795708 9:89657360-89657382 CAGGCACAGCATCACCAGTGTGG - Intergenic
1057220648 9:93256151-93256173 ACATGACAGCAGAAGCAGTGAGG - Intronic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1058280042 9:103103129-103103151 AGTTGACAGCTGCAGCAGTGAGG - Intergenic
1058947858 9:109875647-109875669 CAGTGACAGCATCACCTGGGAGG + Intronic
1060330704 9:122666597-122666619 GAGTGCCTGCAGCAGCAGTGAGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060714287 9:125908243-125908265 CAGTGAGGGAAGCAGCTGTGTGG + Intronic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1061861014 9:133468860-133468882 CAGAGCCTGCAGCAGCTGTGTGG + Exonic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1062286388 9:135774863-135774885 GGGTGAGGGCAGCAGCAGTGAGG + Intronic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1186562745 X:10630401-10630423 CAGTGATTGCAGAAGCTGTGAGG + Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1186872954 X:13790379-13790401 CAGTGTCAGCTTCAGCAGGGAGG + Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1188707892 X:33357806-33357828 CAGTGGCAGGAGCAGCAAGGTGG - Intergenic
1189131498 X:38502742-38502764 TAGAGACAGCAGCAGCACTGGGG + Intronic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1189999348 X:46670534-46670556 CAGTGATAGCAGCAGCTGCAGGG + Intronic
1190028151 X:46945493-46945515 CAGTGGTAGCAGCAGCACTGGGG - Intronic
1190254714 X:48753892-48753914 AGGTCACAGCAGCTGCAGTGTGG - Intergenic
1191800349 X:65072738-65072760 CAGTGGCAGCAGCAACATGGTGG + Intergenic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1193168401 X:78307768-78307790 GAGTGGCAGCAGCAGAAGTGTGG + Intronic
1193585717 X:83318914-83318936 CTGTGAAAGCAGCCACAGTGAGG + Intergenic
1194316001 X:92379025-92379047 CCATGACACCAGCTGCAGTGGGG + Intronic
1194348171 X:92792812-92792834 CACCGCCAACAGCAGCAGTGCGG + Intergenic
1195528637 X:105924872-105924894 CAGTGAAAGAAGAGGCAGTGAGG + Exonic
1196214622 X:113035924-113035946 CAGTGGCGGCAGCAGCAGCTTGG - Intergenic
1196683821 X:118494915-118494937 CACTGACTGCACCAGGAGTGGGG - Intergenic
1196683839 X:118494986-118495008 CACTGACTGCACCAGGAGTGGGG - Intergenic
1196986853 X:121282725-121282747 CAGTGGCAGCATCAGCTCTGGGG + Intergenic
1199732864 X:150653719-150653741 CACTGACAGCCCCAGCAGGGTGG + Intronic
1199769388 X:150964684-150964706 CAGTGGCAGCAGCAACAGCAAGG + Intergenic
1200624050 Y:5490599-5490621 CCATGACACCAGCTGCAGTGGGG + Intronic
1200656500 Y:5909441-5909463 CACCGCCAACAGCAGCAGTGTGG + Intergenic
1201903517 Y:19066713-19066735 CCGTGACTGGAGCAGCACTGTGG + Intergenic
1201909967 Y:19124174-19124196 CAAAGACAGGAGCAGCAGAGGGG - Intergenic