ID: 1053330982

View in Genome Browser
Species Human (GRCh38)
Location 9:37206777-37206799
Sequence TCCTGGCCACCTTGTAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053330982_1053330987 25 Left 1053330982 9:37206777-37206799 CCTCCCTTACAAGGTGGCCAGGA 0: 1
1: 0
2: 3
3: 14
4: 168
Right 1053330987 9:37206825-37206847 TACCTATTTCCTTTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053330982 Original CRISPR TCCTGGCCACCTTGTAAGGG AGG (reversed) Intronic
901740409 1:11338247-11338269 CCCTGGCGACCGTGAAAGGGAGG - Intergenic
902686304 1:18079883-18079905 TCCTGCCCACCCTGGGAGGGAGG + Intergenic
902955734 1:19923207-19923229 TCCTGCCCACCTTGGCAGGTTGG + Intronic
903515238 1:23905950-23905972 TCCAGGCCACCTTGCAAGTTTGG - Intronic
903618703 1:24681889-24681911 TCGTGGGCACATTGTGAGGGAGG - Intergenic
903772131 1:25770602-25770624 TCCTGGGCACCCTGCAAGGCAGG - Intronic
903941585 1:26935469-26935491 TTCCTGCCACCTTGTAAAGGTGG - Intronic
904268031 1:29329064-29329086 TCCTGGCCACCTTGTCTGAGAGG - Intergenic
904429209 1:30451183-30451205 TCCAGGCCACCTTGTCTGAGAGG + Intergenic
904658775 1:32069270-32069292 TCCAGCCCACCTTGTAGTGGTGG - Intergenic
905147095 1:35895219-35895241 TCCTGGCCAACTTGTAGGCAGGG - Exonic
906496738 1:46309920-46309942 TACTGGCAACCTTGGAAGGCAGG + Intronic
906700728 1:47856169-47856191 TTCTGCCCACCATGTAAGCGGGG + Intronic
909481309 1:76131012-76131034 TTCTGGCCCCCTTGTCAAGGTGG - Intronic
911251038 1:95576488-95576510 TCCTGGCCAAATTGTGAGGAAGG + Intergenic
914688971 1:150008888-150008910 AACTGGCCACTTTGTCAGGGAGG + Intronic
915167668 1:153957716-153957738 TCCTGGCCTCCTTGGAGGAGAGG - Intronic
915303831 1:154966664-154966686 TCCTGGCAACCCCGTAAGGTAGG + Intronic
916577788 1:166082530-166082552 TCCAGGCCACCTTCTGAGAGTGG + Intronic
918161743 1:181907748-181907770 TCCTGGCTACATGGTAAGTGTGG - Intergenic
918501289 1:185199417-185199439 TTCAGGACCCCTTGTAAGGGAGG + Intronic
918580894 1:186127527-186127549 TCCTGGAAACCATGTAAAGGTGG + Intronic
919425181 1:197421200-197421222 TGCTGGCCATCTTGGAAGTGAGG - Exonic
920536735 1:206742242-206742264 TCCTCACCACCTTCTAAGGTTGG - Intergenic
920871586 1:209799413-209799435 TCGTGACAACCCTGTAAGGGAGG - Intronic
923456312 1:234168526-234168548 TCCTGTCCAACTTGGAACGGCGG - Intronic
923818738 1:237410712-237410734 TCATTGCCACCATGAAAGGGTGG - Intronic
1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG + Intronic
1068233341 10:54200033-54200055 TTCTGAGCACCTTGTAACGGAGG + Intronic
1068536278 10:58244123-58244145 GCCTGGCCACCCTGTCTGGGAGG + Intronic
1071986114 10:91052268-91052290 TCATGGCAAACTTGTAAGAGAGG + Intergenic
1072453235 10:95555765-95555787 TTCTGCCCACCTTGGGAGGGTGG - Intronic
1072923511 10:99596314-99596336 TCATGGCCATCTGGTAAGGAAGG - Intergenic
1074806071 10:117054151-117054173 TCCCTGCCACCATGGAAGGGAGG + Intronic
1075818498 10:125284990-125285012 GGCTGGCCACCATGTAGGGGAGG + Intergenic
1077233897 11:1470761-1470783 TCCTGGCCACCTCCTCAGGAAGG + Intronic
1081018102 11:37907852-37907874 TCCAGGCAACCTTGCAACGGAGG + Intergenic
1081677071 11:44976399-44976421 TCATGACAACCTTATAAGGGAGG - Intergenic
1082943290 11:58731228-58731250 TCCTGGTCACATTATAAGGGAGG - Intronic
1083999138 11:66286788-66286810 TCGTAGCCACCGTGTAAGGCTGG - Intronic
1084032005 11:66486725-66486747 TCAAGGCCACCTGGTAAGGAGGG + Intronic
1087211074 11:95446919-95446941 TCCTCCCCACCTTGAAAGTGGGG + Intergenic
1088587416 11:111371472-111371494 TCCTACCGACCTTGTAAGGTAGG - Intronic
1089124275 11:116165310-116165332 CCATGGCCACCCTGTAAGGTAGG + Intergenic
1090061434 11:123467460-123467482 TCCTGCCCACCTTCTCATGGAGG + Intergenic
1091782237 12:3221100-3221122 TCTTGGCCACCTGCTGAGGGTGG - Intronic
1092221982 12:6720237-6720259 TCCTTATCACCTTGTCAGGGAGG + Intergenic
1092501308 12:9050747-9050769 ACCTCGCCAACTTGAAAGGGGGG - Intergenic
1092672776 12:10882497-10882519 TGCTGGCCTCCTTGTTGGGGTGG + Exonic
1092672792 12:10882560-10882582 TGCTGGCCTCCTTGTTGGGGTGG + Exonic
1092676918 12:10930778-10930800 TGCTGGCCTCCTTGTTGGGGTGG - Exonic
1093129413 12:15371871-15371893 TCCTGGCCGCCTTGTGAAGAAGG + Intronic
1097351624 12:58555468-58555490 TCCTAGCAACCTTGTAAAGTAGG + Intronic
1101345815 12:103885231-103885253 TCCTGGCCCCCTTGTTGGGTGGG - Intergenic
1101734744 12:107454600-107454622 TCCTTGCCACCTTTTCAGGCAGG + Intronic
1103212675 12:119178471-119178493 GCTTGGCCATCTTGTAAGTGGGG + Intergenic
1106033321 13:26021960-26021982 TCCTGGTCACCTCATAAGTGAGG - Exonic
1113211870 13:107993015-107993037 TCCCTGCCACCTTGTGAGGAAGG - Intergenic
1113518999 13:110924969-110924991 TCCTGGCCCCCTTGAATGGATGG + Intergenic
1113543048 13:111123754-111123776 TCCTCACCACCCTATAAGGGAGG + Intronic
1115367356 14:32573082-32573104 TCCTGGACAGCTTGTCAGGGAGG + Intronic
1120208555 14:81612105-81612127 TTCTGTCCACCTTGTGGGGGTGG + Intergenic
1121908447 14:97768321-97768343 TGCTGGCCACCGTCTAAGGGAGG - Intergenic
1125031937 15:35082544-35082566 GCCTGGCCACCCTGTCTGGGAGG + Intergenic
1128326396 15:66726647-66726669 TCCTGGCCCCCAGGTAGGGGTGG - Intronic
1128906428 15:71471742-71471764 TCCCGGCCACCCAGTAAGGAAGG - Intronic
1128975635 15:72151131-72151153 TCCTCCCTAACTTGTAAGGGAGG + Intergenic
1129229818 15:74190959-74190981 TCCTGGGCCCCTTGGGAGGGAGG - Intronic
1129323712 15:74788745-74788767 TCCTGGCCACATTCTAGGTGGGG - Intronic
1130706049 15:86233900-86233922 CCCTGGCCACCTTGGGAAGGTGG - Intronic
1133283820 16:4681417-4681439 TCTTGGCCACCCTCTGAGGGTGG + Intronic
1134627864 16:15735626-15735648 TTTTGGCCACATTGTAAGAGAGG - Intronic
1135574865 16:23577715-23577737 AGCTCACCACCTTGTAAGGGAGG - Intergenic
1138499102 16:57427623-57427645 TCCCTGCCACCTTGTGAAGGAGG + Intergenic
1140142696 16:72273632-72273654 TCATGGCCACCTTGTGAGGGAGG - Intergenic
1142814007 17:2411263-2411285 TCCTTCCCACCTCTTAAGGGAGG - Intronic
1143753675 17:9050844-9050866 TCCTGAGCACCTGGTAAGGCAGG - Intronic
1145865868 17:28241186-28241208 TCTTTGCTACCTTGTGAGGGAGG - Intergenic
1145954299 17:28843857-28843879 TCCTGGGGACCTTGTCAAGGAGG + Intronic
1147561848 17:41514162-41514184 TCCTGGCCACCGTGGCAGAGCGG - Intronic
1148768583 17:50053943-50053965 TCCTGGCCTCCCTGTGAGGTGGG - Intergenic
1150156039 17:62853898-62853920 TCCTGCCCACCCTGTAAAGAAGG + Intergenic
1151576456 17:74954726-74954748 TCCTGGCCACCTTGCTCGAGGGG - Intronic
1152151510 17:78604152-78604174 TCCTGGCCAGCTTGGCAGGATGG - Intergenic
1159670839 18:71218931-71218953 TCCAGGCTATCTTGTAAGAGAGG - Intergenic
1160098821 18:75901698-75901720 TCCTGAGCACCTTGCACGGGAGG + Intergenic
1160794419 19:938160-938182 TCCTAGCCTCCTTGTGGGGGTGG + Intronic
1161309728 19:3586906-3586928 TCTTGGCCACCTCGTAGTGGCGG - Exonic
1162822943 19:13234506-13234528 TCCTGACCACCCTGTGAGGAAGG - Intronic
1165064782 19:33222616-33222638 TCATGCCCACCTTGCAAGGTAGG - Intronic
1165460772 19:35943056-35943078 TCCTGGCCACCTTGCCAGGTGGG + Intronic
1166130240 19:40741785-40741807 ATCTGGCAACCCTGTAAGGGGGG - Exonic
1166379026 19:42344821-42344843 TCCTACCCACCTTGTCAGGCTGG - Exonic
1167267322 19:48490055-48490077 TCGTGGCCACCTTGGGAGAGGGG - Intronic
1167601625 19:50458409-50458431 TCATGGCCAGGTTCTAAGGGTGG - Intronic
925349086 2:3188671-3188693 TCCTGCCCACCTTGTGAGCCGGG - Intergenic
926139427 2:10359546-10359568 TCCAGGCCACCTGGGAAGTGGGG - Intronic
926409661 2:12589969-12589991 CCCTGGCCCCTTTGCAAGGGGGG - Intergenic
926721578 2:15965329-15965351 TCCTCGCCACCTTGTGAGGTAGG - Intergenic
927098782 2:19770682-19770704 TTCTGGCCACCTTGTGAAGAAGG - Intergenic
929229664 2:39546302-39546324 TCCTGCCAAGGTTGTAAGGGAGG - Intergenic
929472392 2:42208145-42208167 TCCTGGCCACTCTGGGAGGGAGG + Intronic
932332822 2:70907669-70907691 TCCTGTCTACATTGTAAGTGTGG - Intronic
934707933 2:96497763-96497785 TCATGACCACCCTGAAAGGGAGG + Exonic
937534215 2:122866188-122866210 ACCTGACCACTTTGTAAGGATGG + Intergenic
941405542 2:165083203-165083225 TCCTGGGCAAATTGTGAGGGAGG - Intergenic
942453780 2:176124055-176124077 TCCTGGCCACCTCGTAGCGCCGG - Exonic
942499410 2:176573047-176573069 TGCTGGCCACATTGTCAGGAAGG + Intergenic
945350227 2:208768834-208768856 TCATGGCAACCTTGTAAGGTAGG - Intronic
1169111806 20:3038896-3038918 ACCTGGCCACCTTCCTAGGGAGG - Intronic
1169415519 20:5412887-5412909 ACCTGGCCACCTCGTTGGGGGGG + Intergenic
1174946904 20:54996081-54996103 CCCTGGCCTCTTTGCAAGGGTGG + Intergenic
1175303464 20:57959513-57959535 TCCTAGCCACCTTATGAGGAAGG - Intergenic
1179419196 21:41222454-41222476 CCCTGGCCACCTTGCTGGGGTGG - Intronic
1179800105 21:43807749-43807771 TCCTGACATCCTTGTAAGGGAGG - Intergenic
1181365364 22:22372372-22372394 TCCTTGCCTCCTTCTCAGGGCGG + Intergenic
1182070661 22:27461526-27461548 TCCTGGCCACCTTGCCTGGGTGG + Intergenic
1183073448 22:35412032-35412054 TCCTGGACACGTTTTAAAGGTGG - Intronic
1183581707 22:38730384-38730406 TCCTACCCACCCTGTAAGGAAGG + Intronic
1183717474 22:39542083-39542105 TCCTGGCCACATTTTGAGGTGGG - Intergenic
1184160502 22:42694593-42694615 TCCTGGCCACCAGGAAAGAGAGG - Exonic
1184549123 22:45195113-45195135 TCATGGTCACCCTGTGAGGGGGG + Intronic
1184745037 22:46451207-46451229 TCCTGGCTACCTTGCCAGGTGGG - Intronic
1185284356 22:49993775-49993797 TCCTGGCCACCGTGGAGGTGGGG - Intergenic
949498409 3:4655355-4655377 TCCTGGCCTCCTGGTACAGGAGG + Intronic
950613476 3:14140694-14140716 TCATGCCCACCCTGTAAGGTAGG - Intronic
950807687 3:15621131-15621153 GCCTGCCCACATTGTGAGGGTGG + Intronic
956178389 3:66495807-66495829 TCCTGTCCACCCTGAAAGAGAGG + Intronic
958406821 3:93763238-93763260 GCCTGGCCACCCTGTCTGGGAGG - Intergenic
960962593 3:123082808-123082830 TCCTCTCCACCTTGTAGGTGGGG + Intronic
962314050 3:134347623-134347645 GCCAGGCCACATTGTCAGGGAGG + Intergenic
966687445 3:182711372-182711394 TCATGTTAACCTTGTAAGGGAGG - Intergenic
966817069 3:183897985-183898007 TTCTGGCCTCCTTGCAAAGGAGG + Intergenic
969622405 4:8285291-8285313 TCATGGGCACCCTGCAAGGGGGG - Intronic
972771707 4:42203434-42203456 TCCTGCCCATCTTGAAAGTGGGG - Intergenic
976375784 4:84343126-84343148 TTCAGGAGACCTTGTAAGGGAGG - Intergenic
978089577 4:104698513-104698535 TCCTGTCCAAATTGCAAGGGAGG - Intergenic
978498681 4:109386019-109386041 TCCTAGACAGCTGGTAAGGGTGG - Intergenic
980012169 4:127608844-127608866 TTCTGTGCACCTTGTGAGGGAGG - Intergenic
980635954 4:135503252-135503274 TTCTTGCCACCTTGTAAAGAAGG - Intergenic
984784955 4:183559022-183559044 TCCTGGATACCTTGTTAGAGAGG - Intergenic
986514916 5:8551265-8551287 TTCTGGCCTCCTTGGAAGAGTGG - Intergenic
990724957 5:58743178-58743200 TCATGGCCACCTTGTAAGTTAGG - Intronic
992878669 5:81083218-81083240 GCCTTGCTCCCTTGTAAGGGTGG + Intronic
998249175 5:140538516-140538538 TCATGGCCAGCTTTTAAGAGGGG - Intronic
999449487 5:151667509-151667531 TCCTGGTCACCCTGTATGAGAGG - Exonic
1002060731 5:176624285-176624307 TCCTGACCACCTTATAAGGGAGG + Intronic
1004723566 6:18290150-18290172 TCCTGGCCACCATGGGAGAGGGG + Intergenic
1006896355 6:37473620-37473642 TCCTGCCCAGCTTGGAATGGTGG + Intronic
1007809718 6:44477172-44477194 CCCTGGCCACCTGGCAAAGGGGG - Intergenic
1007916760 6:45568562-45568584 AGCTGGCCACCTTGAAAGGCAGG + Intronic
1010810370 6:80293025-80293047 TCCTGGCCACTTTCTCAGGCTGG + Intronic
1011263143 6:85489180-85489202 TGCAGGCCACCTTGCATGGGAGG + Intronic
1015854465 6:137608694-137608716 TCCTGGGGACATGGTAAGGGAGG + Intergenic
1016703550 6:147080493-147080515 TCATGGCCACTTTGAAAGGTAGG + Intergenic
1020263281 7:6543539-6543561 TCCTGGCCACCCTGTCAAAGTGG + Intronic
1022423853 7:30248847-30248869 TCATAACCACCTTGTAAGGGAGG + Intergenic
1022438710 7:30414158-30414180 TCTTGGCCACTTTGTAAGCCAGG - Intergenic
1027774205 7:82444032-82444054 TCCTGGCTGCCTTGTATGGAGGG - Intergenic
1027901287 7:84118505-84118527 TGCTGGCCACGTTGTTAGCGTGG + Intronic
1031233346 7:119139611-119139633 TCCTTGCCACCTTGTGAAGAAGG - Intergenic
1032162422 7:129520986-129521008 TCCTGGAGACCATGTGAGGGTGG - Intergenic
1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG + Intergenic
1034310906 7:150086745-150086767 TCCCGGTCACATTGTGAGGGAGG - Intergenic
1034795940 7:154013889-154013911 TCCCGGTCACATTGTGAGGGAGG + Intronic
1035680590 8:1484622-1484644 TCCTGTCCAGCTTGTAAGTTGGG - Intergenic
1038109368 8:24478549-24478571 TCCTGCCCACGTTGAAAGGGAGG + Intronic
1039407970 8:37328921-37328943 TCTTGTCCACATTGTAAGGTGGG + Intergenic
1049156597 8:141070968-141070990 TCCTGGCCTCCGCGTCAGGGAGG - Intergenic
1049196473 8:141318403-141318425 TCCAGGCTACCTAGTGAGGGAGG + Intergenic
1050722052 9:8601321-8601343 TCCAGGCCTTCTTTTAAGGGTGG - Intronic
1053330982 9:37206777-37206799 TCCTGGCCACCTTGTAAGGGAGG - Intronic
1053715837 9:40886031-40886053 GCCTGGCCACCCTGTCTGGGAGG - Intergenic
1054076707 9:60544709-60544731 GCCTGGCCACCCTGTCTGGGAGG + Intergenic
1059490392 9:114661741-114661763 TCCTCTCCACCTTGCAAGGCAGG + Intergenic
1061002238 9:127908912-127908934 TCCTGGGCTCCTGGTGAGGGAGG + Intronic
1061746766 9:132745804-132745826 TGGTGGCCACCTTGTACGGATGG - Intronic
1061882098 9:133573724-133573746 TCATGGCCGCCTGGGAAGGGTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062549717 9:137080414-137080436 TCCTGGCCAGGTTGCCAGGGCGG + Intronic
1187924246 X:24235850-24235872 AACTGGCCATCTTGCAAGGGTGG + Intergenic
1188606889 X:32042380-32042402 TTCTTGCCACCTTGTAAAGGAGG - Intronic
1192995409 X:76507328-76507350 TACTGGCCACCCTGAAAGGAAGG - Intergenic
1193889460 X:87026913-87026935 TTCTTGCCACCTTGTAAAGAAGG - Intergenic
1194646648 X:96465830-96465852 TCCTTGCCACCTTGTGAAGAAGG - Intergenic
1199871381 X:151901760-151901782 TCCAGGCCACCTAGAGAGGGAGG + Intergenic