ID: 1053336964

View in Genome Browser
Species Human (GRCh38)
Location 9:37283315-37283337
Sequence TTTGTTTTCTCCTGAAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 496}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053336964 Original CRISPR TTTGTTTTCTCCTGAAACTA TGG (reversed) Intronic
903093965 1:20951495-20951517 TTTTTTTCCCACTGAAACTAAGG - Intronic
903719181 1:25391709-25391731 TTTGTTTTCAACTGAAAGGAGGG - Intronic
904553531 1:31341919-31341941 TTTCTTTTTTCCTCATACTATGG + Intronic
905158171 1:36006185-36006207 TGTGTTCTCTCCTGTATCTATGG + Intronic
907614303 1:55908116-55908138 TTTTCTTTCCCCTGAAACTGTGG - Intergenic
907807190 1:57832752-57832774 TTTGTTCTCTCCTGAGTCTTTGG + Intronic
908301602 1:62766475-62766497 GTTGTTTCCTCCTGTAACTAGGG - Intergenic
908406799 1:63822209-63822231 TTTGTTTTCTGATGAAACTGTGG + Intronic
908563659 1:65332143-65332165 TTTTTTTTCTCCTATAAATATGG + Intronic
908837482 1:68242466-68242488 TTTGTTTACTATTGAAACTCTGG + Intergenic
910508414 1:87976862-87976884 TTTGTTTTCTCCTGGAAGAAAGG - Intergenic
910570432 1:88695440-88695462 TTTTTTATCTCCTGAAGCTTTGG + Intronic
910920372 1:92339627-92339649 TTTTTTTTCTCCTACATCTAAGG + Intronic
911335568 1:96576206-96576228 TTTTTTTTTTCCTGTAACTTTGG + Intergenic
911862039 1:102963955-102963977 TTTGTCTTCACATGAAAGTATGG + Intronic
911890031 1:103356631-103356653 TTTCTTTTCTCCTGATAATTTGG - Intergenic
912116566 1:106414538-106414560 TTTGTTTTCTGCTTTACCTATGG + Intergenic
912478246 1:109956845-109956867 TCTGTATCCTCCTGAAGCTATGG - Intergenic
912618822 1:111134859-111134881 TTTGTTTTTTCCAGACAGTATGG + Intronic
912769901 1:112453768-112453790 TTTGTCTTCTCCTTAAAATTGGG + Intronic
912929720 1:113946621-113946643 TTTGTTTTTTATAGAAACTAAGG + Intronic
912980449 1:114366361-114366383 TGGGTTTTCTCCTGGGACTATGG + Intergenic
913472055 1:119197948-119197970 TTTGTTATCTTCTGAAACAATGG - Intergenic
913665479 1:121044304-121044326 TTTGTTTTCTTCAGAAATCAAGG - Intergenic
914016874 1:143827573-143827595 TTTGTTTTCTTCAGAAATCAAGG - Intergenic
914160912 1:145133438-145133460 TTTGTTTTCTTCAGAAATCAAGG + Intergenic
914655484 1:149736114-149736136 TTTGTTTTCTTCAGAAATCAAGG - Intergenic
914931950 1:151942807-151942829 TTTGGCTTCTCTTGAAACTGTGG + Intergenic
915066888 1:153232144-153232166 TTTTCTTTCTCCTCAAACTGGGG - Intergenic
915815740 1:158962921-158962943 TTTGTTTCTTCCTTGAACTAAGG - Intronic
916360225 1:163959638-163959660 TTTGTTTCCACCTGACCCTAAGG + Intergenic
916470512 1:165118438-165118460 TTTGCTTTCTCCTCAATCCAGGG - Intergenic
917098983 1:171426979-171427001 CTTGTTTTCTCCTCAAAGAAAGG + Intergenic
917618806 1:176773831-176773853 ATTCTTTTGTCTTGAAACTATGG - Intronic
917630416 1:176886178-176886200 TTCGTTTCCCACTGAAACTAAGG + Intronic
918454707 1:184696744-184696766 TTTGTTCTCTCTTGAATTTAGGG - Intronic
919224514 1:194678371-194678393 TATGTTTTCTCCACAAACTGTGG + Intergenic
919402222 1:197133434-197133456 TTTGTTTACTTCTGAAAAAATGG - Exonic
919429967 1:197480545-197480567 TTTGTCTTCTCCTTGAATTAGGG + Intergenic
920403797 1:205693999-205694021 TTAGTTTTCTCCAGAAGGTAGGG - Intergenic
920613560 1:207466748-207466770 TTTGTATCCTCCTGGTACTATGG - Exonic
921180182 1:212625827-212625849 TTTGTTTCCTCCTGCACCGATGG - Exonic
921352345 1:214249102-214249124 TTTTTTTTTTCCTGGAACAAAGG - Intergenic
921483166 1:215687005-215687027 TGTGTTTTCTCCTGATACTGGGG + Intronic
921673708 1:217953953-217953975 TTTGTTTCGTGCTGAAACCAGGG - Intergenic
921816062 1:219564775-219564797 TTTGTGTTTGCCTGAATCTAGGG + Intergenic
921906825 1:220504132-220504154 TTTGTTTTCTAATAAAACTGGGG + Intergenic
922431582 1:225560176-225560198 TTTTTTTTTTCCTGAGACAAGGG + Intronic
922988206 1:229883037-229883059 TCTGTTTCCTACTGAAACTCTGG + Intergenic
923154478 1:231265694-231265716 TTTGTTTTCTCTTTAAAGAATGG + Exonic
923487336 1:234446254-234446276 TTTCTTCTCTCCTTAAACTAAGG - Intronic
923862141 1:237902196-237902218 TTTTTTTTCTCCTCAAAGCATGG - Intergenic
924143047 1:241046118-241046140 TTTGTTTTCTGCTGAGATTTGGG + Intronic
924165075 1:241272492-241272514 TTTGATTTCTGCTCAAATTATGG + Intronic
924165603 1:241278914-241278936 ATTCTTTTCTCCAGAAAATAAGG - Intronic
924288501 1:242512710-242512732 TTGATTTTCTCCTGAGACTTGGG - Intronic
924549806 1:245064829-245064851 TTTTTTTTTTCCTGAAACTCTGG + Intronic
924852134 1:247841249-247841271 TTTGTTTTTTTCTGACACTGGGG - Exonic
924891961 1:248292774-248292796 TTAGTTTTCTCCTGAACATTAGG + Intergenic
1063495831 10:6507050-6507072 TTTGTATTCTACTGATAATATGG + Intronic
1063854934 10:10238929-10238951 TTCGTTTTCTGCTGAATATAAGG - Intergenic
1064583174 10:16814439-16814461 TTTTTTTTTTCCTGAAAACAGGG - Intronic
1064697039 10:17977504-17977526 CTTGTTTTCTAATGCAACTATGG - Intronic
1064778458 10:18806530-18806552 TATGTTTCCTCCTGCAACCATGG - Intergenic
1065681810 10:28243172-28243194 TTTGGTTTCCCTTGAAAGTATGG - Intronic
1066682739 10:37949806-37949828 TTTGTTTTCTCCCAAATCAATGG - Exonic
1067321172 10:45222558-45222580 TTTTTTTTTTCCTGAAAACAGGG - Intergenic
1067392445 10:45876299-45876321 TTTGTTTTCCTCTAATACTAAGG - Intergenic
1067792862 10:49301003-49301025 TTTGTCTTTTCCTGACCCTAAGG + Intronic
1067860518 10:49842381-49842403 TTTGTTTTCCTCTAATACTAAGG + Intronic
1068221767 10:54054316-54054338 TCTGTTTGCTCCTTAAACTTTGG - Intronic
1069013101 10:63396787-63396809 TTTTTTTTTTGCTGAATCTAAGG - Intronic
1069152025 10:64974704-64974726 TTTGTTTTTTCCTAAAACAAGGG - Intergenic
1069562021 10:69437355-69437377 TTTGTTTTCTCCTGGGCCCATGG + Intergenic
1070029024 10:72658932-72658954 TTTTTTTTCTCCTCATTCTAAGG + Intergenic
1072380152 10:94859473-94859495 TCTGATTTCTCCAGTAACTAGGG - Intergenic
1074027200 10:109648881-109648903 TTAATTTTCTCATTAAACTATGG - Intergenic
1074451094 10:113560178-113560200 TTTGCTTTCACCTGAAGCTCAGG - Intronic
1074553076 10:114463245-114463267 TTTGTTTTCCCTTGGAACGATGG - Intronic
1075884234 10:125883634-125883656 TTTGTTGTCTCATGATACTTTGG - Intronic
1078284556 11:9938687-9938709 TTTATTTTCTTCTGAAAGAATGG - Intronic
1078825599 11:14927314-14927336 TTTGTTTTCTCATGATTCTGTGG + Intronic
1079383316 11:19957928-19957950 CTTGTCTTCTCAGGAAACTAGGG + Intronic
1079704970 11:23604009-23604031 TTTGTTTTGTCTTTGAACTAGGG + Intergenic
1079827930 11:25221598-25221620 TTTGTGTTTTCCTGATAATAAGG + Intergenic
1079881299 11:25930387-25930409 TTTGTTTGCTTCTGAATCTTAGG - Intergenic
1080212683 11:29805319-29805341 TTTTTTTTTTTCTGAGACTAGGG - Intergenic
1080900767 11:36488400-36488422 TTGGCTTTCTCTTGAAATTAAGG + Exonic
1081113316 11:39164845-39164867 TTTTTTTTTTCCAGAAAATAAGG - Intergenic
1081394451 11:42569205-42569227 TTTTTTTTCTCTTGTAACTTTGG - Intergenic
1082256961 11:50042411-50042433 CTTGTTTTCTCCCAAAATTAAGG - Intergenic
1084199000 11:67543059-67543081 TTTGTTTTGTCCTTAAATTCTGG + Intergenic
1087361427 11:97165226-97165248 ATTATTTTCTCCTGATATTAAGG + Intergenic
1087832692 11:102836766-102836788 TTTGTTTTCTACTCAAGGTAAGG - Intronic
1087844801 11:102960862-102960884 ATTGTTTTCTCTTAAAAATAGGG + Intergenic
1088510063 11:110565083-110565105 TTTGGCTTCTCCATAAACTAAGG - Intergenic
1088783715 11:113161920-113161942 TTTTTTTTCCCCTGAAACCTTGG + Intronic
1090339887 11:126008191-126008213 TTTGTTTTTTCCAGAGACTTTGG - Intronic
1090878069 11:130808917-130808939 TTTGTTTCCTCCAGAGACTTGGG + Intergenic
1091706079 12:2694353-2694375 ACTGTTTTCTCCTGACACTTGGG - Intronic
1091926872 12:4358514-4358536 TCTGTTTTCCCCTGAAACATTGG + Intergenic
1092763210 12:11828067-11828089 TTTTTTTTCTTCTTAAACTCAGG + Intronic
1093565314 12:20595962-20595984 TATGTTTTTTTCTGAAAATAAGG - Intronic
1093688316 12:22081778-22081800 TTTGCTTTATCCTGAAAATAAGG + Intronic
1093864945 12:24215169-24215191 ACTGTTTTCTCCTTAAACTAAGG + Intergenic
1093896174 12:24576809-24576831 TTTCCTTTCTCTTGAAATTATGG - Intergenic
1093987152 12:25548190-25548212 TTTTTTTTCTCCTGCCATTATGG - Intronic
1094028990 12:25989162-25989184 AATGTTTTCTCTTAAAACTAAGG + Intronic
1094333162 12:29318772-29318794 TTTTTTTTCTACTGCAAATAGGG + Intronic
1094612928 12:32010971-32010993 TTTGTTTACCCCTGAGACCAAGG + Intergenic
1094641189 12:32276995-32277017 TTAGTTTTCTTCTAAAAGTAGGG - Intronic
1094765464 12:33589453-33589475 TTTGTTTTGTCCTGAATAAATGG + Intergenic
1095265120 12:40147326-40147348 TATCTTTTCTTGTGAAACTATGG + Intergenic
1095461281 12:42446771-42446793 TTTATTCTCTCCTGAAGCTTTGG - Exonic
1095656758 12:44679172-44679194 TTTCTATTCCACTGAAACTAGGG + Intronic
1096007017 12:48181805-48181827 TTAGATTACTCCTGAAACTCTGG - Intergenic
1097723723 12:63050892-63050914 GCTGTTTTCTCCTGAAGCTATGG + Intergenic
1098324002 12:69281194-69281216 TAAGTTTGCTCCTGAAAGTATGG + Intergenic
1098496006 12:71136222-71136244 TTTTTTTTCCTCTGAAACTCTGG + Intronic
1098647576 12:72923575-72923597 TTTCTTTTCTTCTCAATCTAAGG - Intergenic
1098818385 12:75197458-75197480 TTTGTTTCCTCCTTAACCTGTGG + Intronic
1099877980 12:88432792-88432814 TTTGTTTTCTCCTGGATGTGTGG - Intergenic
1100300887 12:93306802-93306824 ATTGTTTTCTCCTGTGAGTAAGG - Intergenic
1103833950 12:123804063-123804085 TTTGTTTTTTTCTGAGACGAGGG + Intronic
1104521234 12:129477254-129477276 TTTGATTTCTTTTGAAAATAAGG + Intronic
1104566763 12:129892242-129892264 CTGTTTTTCTCCTGATACTAAGG + Intronic
1105024103 12:132837328-132837350 TTTGTTTTCTTCTGAAGAGAAGG - Intronic
1105468081 13:20665999-20666021 TTTGTTTTCTCTTGAATTTACGG + Intronic
1105575386 13:21646412-21646434 TTTGTTGTCCCCTGAAGTTAGGG + Intergenic
1106067988 13:26376780-26376802 TTTTTTTTCTGCAGATACTATGG - Intronic
1106099927 13:26685582-26685604 TTTTTTTTCTACTGACACTAAGG - Intronic
1106249673 13:27973976-27973998 CTTCCTTTCTTCTGAAACTAGGG + Intergenic
1106450718 13:29879684-29879706 TTTGGGTTCTCCAGACACTATGG - Intergenic
1106683982 13:32037272-32037294 TTTATTTACTTTTGAAACTAGGG - Intronic
1106726745 13:32494444-32494466 TTTGTTTTCTCCTGTGAATGAGG - Intronic
1107358194 13:39590926-39590948 TGTGTTTGCTGGTGAAACTAAGG + Intronic
1107587752 13:41870249-41870271 TTTTTTTTTTCATGAAATTAAGG - Intronic
1107657685 13:42608821-42608843 ATTATTTTTTCCTTAAACTAAGG - Intergenic
1108076758 13:46688074-46688096 TTTGTTTTCTGCAGATACCATGG - Intronic
1108213681 13:48162742-48162764 TTTTTTTTCCCATGAGACTATGG - Intergenic
1108466649 13:50723324-50723346 TTTGTTGTTTCTTTAAACTAGGG - Intronic
1108872656 13:55005618-55005640 TTTTTTTTCTCCTAAACCTCTGG + Intergenic
1109060808 13:57617543-57617565 TTTGTTTGCTCCTGAATGTGTGG - Intergenic
1109632124 13:65063280-65063302 TCCATCTTCTCCTGAAACTAAGG - Intergenic
1109649404 13:65306786-65306808 TTTGTTTTCTCCAGGTACTCTGG - Intergenic
1109808383 13:67474569-67474591 TTTGTTATCACATGAAACTTGGG + Intergenic
1109966004 13:69697134-69697156 TTAGTTTTCACCTGAAAATATGG - Intergenic
1111205453 13:85002770-85002792 TTTGTTGCCTCATGAAACTCTGG + Intergenic
1111236765 13:85419221-85419243 TTTGTTTTATCCTAAAATTTGGG + Intergenic
1112589869 13:100753030-100753052 ATTGTTTTCTTCTGGAAATATGG - Intergenic
1112718858 13:102218675-102218697 TTTCTTTTCGCCTGCATCTATGG + Intronic
1113813018 13:113153682-113153704 TTGTTTTTCTCCTGGAACTGGGG - Intergenic
1114596694 14:23918310-23918332 TTTGTTTCTTCCTTAAACAAAGG - Intergenic
1116436059 14:44896912-44896934 TTTGTTTTCTCAGTAAATTACGG - Intergenic
1116502593 14:45638420-45638442 TTTGTTTTTTTCTTAAACTCAGG + Intergenic
1116680408 14:47961900-47961922 TTTGTTTTCTGCTGACACTGTGG + Intergenic
1117459648 14:55932290-55932312 TCTGTTATCTCCTGGAACTCTGG + Intergenic
1117470554 14:56040296-56040318 TCCATGTTCTCCTGAAACTATGG + Intergenic
1117562986 14:56963141-56963163 TATGGTTTCTCCTGAAATAATGG + Intergenic
1117876312 14:60253685-60253707 TTTGTTAACTTCTGAAACTTTGG - Intronic
1119054797 14:71408439-71408461 TTTCTTTTATTCTGAAACTGGGG - Intronic
1119178044 14:72583961-72583983 TTTGTTTTCTCCTGCACCACTGG - Intergenic
1119294948 14:73525527-73525549 GATGTTTTCTCCTGAAACAGTGG + Intronic
1119345754 14:73922585-73922607 TTTCTTTTCTCCAGAAGATATGG - Exonic
1120829771 14:88987548-88987570 TTTTTGTTCTCCTGATGCTATGG + Intergenic
1121457274 14:94046481-94046503 TTTTTTTTCTCCTTAAGTTAGGG - Exonic
1121983158 14:98472510-98472532 TTTGTCTTTCCCTGAAACAAAGG + Intergenic
1122677252 14:103425801-103425823 TTTGCTTCCTCCTGAAAATGGGG + Intronic
1124090387 15:26594276-26594298 TTTTTTTTCCCCTGAAACTTGGG + Intronic
1126527990 15:49678994-49679016 TTTGTCCTGTCATGAAACTAGGG - Intergenic
1127742998 15:61931986-61932008 TTTGTTTTCTCAAGGAATTAGGG - Intronic
1128487778 15:68112137-68112159 TATGTTTTCTTCTGTAACTGAGG + Intronic
1128719606 15:69938641-69938663 TTTGTTTCCCCCTGAAACAATGG - Intergenic
1129531222 15:76266453-76266475 TTTGTGTGCAGCTGAAACTAGGG + Intronic
1130839173 15:87681653-87681675 TTTTTTTTTTCCTGAAGCTTGGG - Intergenic
1131298601 15:91174468-91174490 TTTTTTTTCTCCCTAAACAAAGG - Intronic
1133340760 16:5034179-5034201 TTTTTTTTTTCCTGAACCAATGG + Intronic
1133649032 16:7792120-7792142 TTTTTTTCCTCCAGAAATTAGGG + Intergenic
1133757052 16:8769655-8769677 TTTGTCTTCTCCTGAGTCTTGGG + Intronic
1138128800 16:54460916-54460938 TTTTTTGTTTCCTAAAACTAAGG - Intergenic
1139022235 16:62763879-62763901 TTTGTTTTCTAAAGAAAATAAGG - Intergenic
1139456455 16:67082117-67082139 TTTTTTTTTTCCTGAAACAGTGG - Intronic
1140175903 16:72659449-72659471 TTTCTTTTCTTCTGTTACTATGG + Intergenic
1140322184 16:73963543-73963565 TTAGTTTGCTCATGAATCTACGG - Intergenic
1141288879 16:82699037-82699059 TGTTTTTTCTTCTTAAACTAGGG - Intronic
1143673987 17:8417377-8417399 TTTTTCTTTTCCTGAACCTATGG + Intronic
1144517426 17:15928352-15928374 TTTTTTTTTTTCTGAAAGTATGG + Intergenic
1146051149 17:29554496-29554518 TTTGTTTTCTCCTCACAATTGGG + Intergenic
1146260979 17:31420779-31420801 TTTATTTTCTCTTGAGACTTTGG + Intronic
1147756260 17:42770239-42770261 TTTCTTTTACCCAGAAACTAAGG + Intergenic
1148716801 17:49721781-49721803 TTTCTCTTCTCTTGAAAATAAGG + Intronic
1149016486 17:51914329-51914351 TGTGTTTTCCCCTGACTCTATGG + Intronic
1149771959 17:59329676-59329698 TTTATTGTCTCCTGACCCTAAGG + Intergenic
1150321457 17:64217773-64217795 TTTGTAGTCTGCTGGAACTATGG - Intronic
1151021121 17:70618663-70618685 TTTGTGTTATCCTCAAACTGAGG + Intergenic
1151060793 17:71091395-71091417 TTTTTTTTCACCTGTAAATAAGG - Intergenic
1151141472 17:71996609-71996631 ATTTTTTTTTCCTGAACCTAAGG + Intergenic
1151488910 17:74420439-74420461 TTTTTTTTTCCCTGAAACTGAGG + Intergenic
1153218955 18:2846288-2846310 TTCTTTTTCTATTGAAACTAAGG - Intergenic
1153424339 18:4945611-4945633 TTTGTTTTTTCCTCAGACCAAGG - Intergenic
1154249973 18:12736303-12736325 TTTGATTTCTCCTGACGGTATGG - Intergenic
1155397050 18:25397778-25397800 TTTGTTTACTCCTGCAACCCAGG + Intergenic
1155584612 18:27350673-27350695 TTTTTTTTCTACTGCAAATAAGG - Intergenic
1155840539 18:30637179-30637201 TTTGTTGTATCCTGAAAGCAAGG + Intergenic
1156259993 18:35437422-35437444 TTTATGTTCTCAAGAAACTATGG - Intergenic
1156353608 18:36322403-36322425 TTTCTTTTCTGCTGAATCTCAGG + Intronic
1156940154 18:42757544-42757566 TTTGTTTTCTGTAGATACTAGGG - Intronic
1157037932 18:43998994-43999016 TTTTTTTTTTTCTGAAAATATGG - Intergenic
1157158226 18:45288343-45288365 TTTGTTTGCTCATGAGTCTAGGG - Intronic
1157350298 18:46878354-46878376 CTTGTTTTTTCCTGAAATTTTGG - Intronic
1158051032 18:53220212-53220234 TTTGTTTTTTTCTGAAATTGGGG + Intronic
1158055484 18:53274703-53274725 TTGGTTTTATTCAGAAACTAGGG + Intronic
1158159598 18:54465959-54465981 TTTGTTTTGTCCTGTAAATGGGG - Intergenic
1158707920 18:59810538-59810560 TTTGTTTTTTCCTGAATATGAGG - Intergenic
1158785137 18:60702462-60702484 TTTGTTTTTTCTTGAAAGAAAGG + Intergenic
1162540736 19:11294408-11294430 TTTTTTTTTTCCTGAAACGGAGG + Intergenic
1165172646 19:33905048-33905070 AATGTTTTCTCCTGTAATTAAGG + Intergenic
1165819785 19:38667123-38667145 TTTGTTTTGACCTGACACGATGG + Intronic
1166439251 19:42796857-42796879 GTTTTTTTCTACTGAAAATAAGG + Intronic
1166467622 19:43046836-43046858 TTTTTTTTCTACTGAAAATAAGG + Intronic
1166474241 19:43107625-43107647 TTTTTTTTCTACTGAGAATAAGG + Intronic
1166488212 19:43232702-43232724 TTTTTTTTCTACTGAGAATAAGG + Intronic
1166494880 19:43293182-43293204 TTTTTTTTCTACTGAAAATAAGG + Intergenic
1167905417 19:52656559-52656581 TGTGTTTTCTACTAAAACCATGG + Intronic
1168130661 19:54316540-54316562 TTTGCTTTCTCCTAATACTGTGG + Intergenic
1168347354 19:55656970-55656992 TTGGTTTTCTCTTTAAACGAGGG - Intronic
1168587855 19:57608543-57608565 TGTGTTGTCTCCAGAAACAATGG - Intronic
925629284 2:5872718-5872740 TTTGTTTTGTCTTGAATTTATGG + Intergenic
926363477 2:12112043-12112065 TTTGTTTTGTCATGAAGCTTGGG - Intergenic
926468689 2:13224969-13224991 TTTGTTTTCTATTGAGACTATGG + Intergenic
928518019 2:32062338-32062360 TTTCTTGTTTCCTAAAACTAAGG - Intergenic
928583971 2:32739392-32739414 TGTTTTTTCTCCTGCAATTAAGG - Intronic
929945962 2:46372042-46372064 TATGTTTTCTGCTGACTCTAGGG + Intronic
930130583 2:47845973-47845995 TTTGTCCCCTCCTGAAATTATGG + Intronic
930479549 2:51929000-51929022 TTTGTTTTCACATGAAATCAGGG + Intergenic
930766420 2:55090065-55090087 TTTTTTTTCTCCTGAGTCTTTGG + Intronic
931158667 2:59664430-59664452 TATATTTACTCCTGAAACTGAGG - Intergenic
931370320 2:61656293-61656315 TTTTTTTTCTTTTGTAACTATGG + Intergenic
931856935 2:66312566-66312588 GTTGTTTTCTCATTAAACTTTGG - Intergenic
931890919 2:66671139-66671161 TTTTTTATCTGCTGTAACTAAGG - Intergenic
932654466 2:73597547-73597569 TTTATTTTCTCCTTAAAAAAGGG - Intronic
932915650 2:75855513-75855535 TTTGATTTCTCCTCAGAATATGG - Intergenic
933024970 2:77244855-77244877 TTTGTTTTCTCATGAACTTTGGG - Intronic
933051540 2:77608959-77608981 TTTTTTTTTTGCTGAAACTTAGG + Intergenic
933054876 2:77649270-77649292 TTTTTTTTCTCATGAAAGTAAGG + Intergenic
933443399 2:82344636-82344658 TTTGTTATCACCTAAAATTATGG - Intergenic
933557233 2:83846115-83846137 TTTGTTTTCTCCAGTAATTGAGG + Intergenic
933736337 2:85498143-85498165 TTTTTTTTCTCCAGAAAAGAGGG + Intergenic
935400055 2:102651024-102651046 TTTGTTTGAACCTCAAACTATGG + Intronic
936240128 2:110780859-110780881 TTTTTTTTTTCTGGAAACTAGGG - Intronic
936742560 2:115531154-115531176 TTTTTTTTTTCCTGAAACAGTGG + Intronic
937704744 2:124906922-124906944 TTTGTTATCTCCACTAACTATGG - Intronic
939071261 2:137546613-137546635 TTTGTTTTTTACAGAAAATATGG + Intronic
939335405 2:140820861-140820883 TTTCTTTTCTGCTGATACTAAGG + Intronic
940135670 2:150433320-150433342 TTGGATTTCTTCTGAATCTAAGG + Intergenic
940145270 2:150539308-150539330 TTTATTTTCTCCTGATCCTGGGG + Intergenic
940517808 2:154702886-154702908 TTTGTTTTACCCAGAAAATAAGG + Intronic
940545799 2:155083016-155083038 TTTGGTTTCTCCTTAAACATTGG + Intergenic
940616467 2:156054747-156054769 GGTGTTTTCTCCTGTAACAAAGG + Intergenic
940715272 2:157215687-157215709 ATTATTTTATCCAGAAACTATGG - Intergenic
942996984 2:182274729-182274751 TTAGTTTTTTCTTGAAACTTAGG - Intronic
943099808 2:183474279-183474301 TGTGTTTTCTTCGGAAACTTTGG + Intergenic
943132714 2:183874823-183874845 ATTATTTTCTTATGAAACTATGG - Intergenic
943448889 2:188023740-188023762 ATTATTTTCTCTTGAAACTCAGG + Intergenic
944655494 2:201873093-201873115 ATTGTTTTTCCCTGAAAATATGG + Intronic
945640592 2:212423019-212423041 TTTGGTTTCTTCTAAAAATATGG - Intronic
945829966 2:214771912-214771934 TTTTTTTTTTCCTGAAACTGGGG - Intronic
946319746 2:218945413-218945435 TTTTTTTTCTTCTTAAACAATGG - Intergenic
946511249 2:220358892-220358914 TTTTTTTGCTTCTGAAAATATGG + Intergenic
946870943 2:224084414-224084436 CCTGTTTTCCCCTGACACTAGGG + Intergenic
946896018 2:224325034-224325056 TTTGTTTTCTTCTGATAATCTGG + Intergenic
947015105 2:225610604-225610626 TTAATTTTCTCCCAAAACTATGG + Intronic
947015419 2:225613978-225614000 TTTGTTTTTTTCTGAAACTTTGG + Intronic
947646048 2:231741370-231741392 TTTGCTTTCTTAAGAAACTAAGG + Intronic
947916398 2:233834698-233834720 TTTTTTTTATCCTGAGAGTATGG + Intronic
948453086 2:238090667-238090689 ATTTTTTTTTCCTGAAAATAGGG + Intronic
1169026172 20:2373453-2373475 TTGGCTTTTTCCTGAAACTATGG + Intergenic
1169241675 20:3986579-3986601 TTTGAGTTCTACTGAATCTAAGG - Intronic
1169661449 20:7982725-7982747 TTTTTTCTATCTTGAAACTATGG + Intronic
1171726561 20:28627034-28627056 TTTGTTTTATCCTGGGACTGTGG - Intergenic
1172075082 20:32289925-32289947 TTTTTTTTCTCCTGCAAATTGGG + Intronic
1173453146 20:43182920-43182942 TTTCTTTTCTCATTAAGCTAAGG - Intronic
1174384413 20:50178580-50178602 TTTATTCTCCCCTGAAACCAGGG - Intergenic
1174946844 20:54995508-54995530 TTTGTTTGCTCCTGTGACTCTGG + Intergenic
1175332417 20:58174724-58174746 TTTTCTTTCTCCTGAAAGAAAGG - Intergenic
1175382201 20:58571065-58571087 TTTTTTTTCTTCTCAAATTAAGG + Intergenic
1177021695 21:15868297-15868319 TTTGTTTTCTCTTGACCCTGAGG + Intronic
1177081363 21:16642174-16642196 GTTGGTTTTTCCTGAAACTTAGG + Intergenic
1177495900 21:21891350-21891372 TTTGTTTTTTCCTGTAAATTTGG + Intergenic
1177553047 21:22650907-22650929 TTTTTTTTTTCCTGAAACAGAGG + Intergenic
1177685259 21:24427834-24427856 CTTTTTTTCTTCTCAAACTAAGG - Intergenic
1177699488 21:24618580-24618602 ATGTTTTTCTCCTTAAACTATGG + Intergenic
1177992829 21:28058944-28058966 TTTTTTTTCTCCTGAATCTCTGG - Intergenic
1178505616 21:33160509-33160531 TTTGTTTTCTCCTGAAGCAGTGG - Intergenic
1179016848 21:37601263-37601285 TTTCTTTTCTCCTGATTCAATGG + Intergenic
1183881147 22:40831607-40831629 TCTGTTTTCTTCTTAAAATAGGG - Intronic
949682084 3:6525903-6525925 TTTCTTTTTTCCTGACACTTAGG - Intergenic
950927894 3:16760653-16760675 TTTGCTTTCTGCTGTAACAAGGG + Intergenic
951352474 3:21623353-21623375 TTTGTTTTTTTCTGAAATGATGG + Intronic
951621928 3:24611562-24611584 ATTGGTTTCTCTTGAAAATAAGG - Intergenic
951766162 3:26202030-26202052 TTTGTGTTCTCCTACAATTAAGG - Intergenic
952362331 3:32643243-32643265 TTTATTTTCTCCTGAAAAACTGG + Intergenic
952912078 3:38199709-38199731 TTTTTTTTCTCCTGGCACTGTGG + Intronic
954771620 3:52975329-52975351 TTTTTTTTCTTCTGATTCTATGG + Intronic
955510017 3:59670267-59670289 TTTGTGTTCTCCTCAATGTATGG - Intergenic
955718793 3:61860350-61860372 TTTTTTTTCTCATCAAACAATGG - Intronic
955727018 3:61944017-61944039 TTTGTTTGCTGCTGGAACCAAGG - Intronic
956128496 3:66033502-66033524 TTTGGTTTCTCATGAATCTCTGG - Intronic
956267022 3:67408119-67408141 TTTGCCTTCTGCTGAAATTATGG + Intronic
956604690 3:71062419-71062441 TTTGTTTTCTTTTGACACTTAGG + Intronic
957189767 3:76992539-76992561 TTTTTTTTCTCACGAAATTACGG - Intronic
957825805 3:85441636-85441658 TTTGTATTTTCCTGGAACTTAGG - Intronic
957930057 3:86865798-86865820 TTTCTCTTCTCCTGATACTTCGG - Intergenic
958106391 3:89079111-89079133 TTATTTTTCTCCTGAAATTCAGG + Intergenic
958134410 3:89469340-89469362 ATTTTTTTTTCCTGAAACTCAGG + Intronic
958557308 3:95696544-95696566 TTTTTCTTTTCCTGAAAGTAAGG - Intergenic
958725503 3:97900687-97900709 TTTGTTTTCTCCTGACAGAGCGG + Intronic
958916173 3:100053045-100053067 TCTATTCTCTCCTGAAACAAGGG + Intronic
959391954 3:105786294-105786316 TTTGTTTCTTACTGAAAATAGGG - Intronic
960319057 3:116211851-116211873 TTTGTTTTTATCTAAAACTAAGG - Intronic
960420859 3:117443812-117443834 TTTGTTTTTTCCTGGAAATAAGG - Intergenic
960725956 3:120670271-120670293 TCTGTTTTCTGCTCAAACTTGGG - Intronic
962551224 3:136494097-136494119 TTTATTTTTTCTAGAAACTAGGG - Intronic
963373065 3:144426779-144426801 TTTCTTGATTCCTGAAACTATGG + Intergenic
964246962 3:154665249-154665271 TTTGTTTTCTTCTAAAAATGAGG + Intergenic
964417592 3:156463871-156463893 TTTGTTTTTTTCTCACACTAAGG + Intronic
964999113 3:162929205-162929227 TTTATTTTCTCATAAAACAATGG - Intergenic
965799074 3:172472945-172472967 GTTATTTACTCTTGAAACTAAGG - Intergenic
967266294 3:187695155-187695177 TTTATTTACTCCTGAACCCATGG - Intergenic
970099047 4:12499765-12499787 TTTGTTATCTCCTGAGGCTATGG - Intergenic
970338647 4:15081499-15081521 TTAGTTGTCTCCTGAATATAGGG + Intergenic
970513069 4:16800138-16800160 TTTTTTTTTTCCTGACAGTAAGG - Intronic
970740147 4:19227976-19227998 ATTGTTTTTTCATGAAAATAAGG + Intergenic
970833277 4:20368853-20368875 TTTCTTCTCTCCTGAAACCCTGG + Intronic
971411370 4:26376077-26376099 TTTAGTTTGTCCTTAAACTATGG - Intronic
971614756 4:28774243-28774265 TTATTATTTTCCTGAAACTATGG - Intergenic
971799380 4:31268597-31268619 TAAGTTATCTACTGAAACTATGG - Intergenic
972286386 4:37652410-37652432 TCTGGTTTTTCCTGAAAATAAGG - Intronic
972314324 4:37911796-37911818 TTTGCTAACTCCTGAAAATATGG - Intronic
972549548 4:40117086-40117108 TTTGTTGGCTTCTGAAATTAAGG + Intronic
975378852 4:73675369-73675391 ATTTCTATCTCCTGAAACTAGGG - Intergenic
975592550 4:76015316-76015338 TTTGTTTACTGTTGAAACTAAGG + Intronic
976324528 4:83755758-83755780 TTTCTTTTCACCTGAAATAATGG + Intergenic
976552017 4:86407391-86407413 CTTTTTTTCTCCTGTAAGTATGG - Intronic
976647050 4:87397727-87397749 TCTGTTTTCTCCAGATTCTAAGG - Intergenic
976725503 4:88212105-88212127 TTGGTTTTCACCTAAAGCTAGGG - Intronic
977258405 4:94766313-94766335 TTTATTATCTCCTGAAATGAAGG + Intronic
977566355 4:98584451-98584473 TTTGTTTGCTCATTCAACTATGG - Intronic
978056622 4:104277272-104277294 TTTGTCTTCTCCTGACCTTAGGG - Intergenic
978405674 4:108376366-108376388 TTTGTTTGTTCCTGAAAGCAGGG + Intergenic
978489404 4:109296050-109296072 CTACTTTTCTCCTGAAAATAGGG - Intronic
978742431 4:112152237-112152259 TTTTTTTATTGCTGAAACTAAGG + Intronic
979150152 4:117301668-117301690 TTTTTTTTCTTCTTAAATTATGG + Intergenic
979215207 4:118155336-118155358 TGGGTTTTCTCCTGATACTCTGG + Intronic
979400018 4:120237934-120237956 TTTTTTTTCTCCTGTAAAGACGG + Intergenic
979427338 4:120584110-120584132 TTTGTTTTCTGATGTAACAAGGG - Intergenic
979443702 4:120784531-120784553 TTTGTATCCTCCTCAAATTAAGG + Intronic
979708752 4:123751987-123752009 TTTTCTTTTTGCTGAAACTATGG + Intergenic
980267207 4:130532623-130532645 TTTGGTTTCTGTTGAAAATATGG + Intergenic
980582315 4:134771108-134771130 TTTTTTTTCTCCAAAATCTAGGG + Intergenic
980712913 4:136593064-136593086 TTTGTTTCATCCTTAAACTTTGG - Intergenic
980827433 4:138089285-138089307 TTTGTTTTAACCTGAACCTGGGG + Intergenic
981024115 4:140058922-140058944 TATGTTTTCTCCTGAGAAGATGG + Intronic
981570195 4:146143347-146143369 TGTGTTTTCTTGTGAAACTCTGG + Intergenic
981648613 4:147029037-147029059 TTTGCTTTATTCTGAAACAATGG + Intergenic
982431059 4:155322600-155322622 TCTGTTTTCTCCTGAATGGATGG + Intergenic
982621755 4:157716472-157716494 TTTGTTTTCTGGTGAAGCTTGGG - Intergenic
982651518 4:158093367-158093389 CTTTTTTTCTTCTGAAAATATGG + Intergenic
982909986 4:161127890-161127912 TGTGTTTTCTTCTGAAGCTCTGG - Intergenic
983593245 4:169438207-169438229 TTTTTTTTCTCCAGTAATTAAGG + Exonic
984447624 4:179856929-179856951 TCAATTTTCTTCTGAAACTACGG + Intergenic
985139510 4:186824685-186824707 TTTCTTTCCTCCTGGAACCAAGG + Intergenic
986453162 5:7886909-7886931 TTTGTTTTCTATTGAAATGAGGG + Intronic
987242124 5:16010905-16010927 TTGGTTTTCATCTGAAACTGGGG + Intergenic
987399014 5:17455726-17455748 ATTGTATTCTCCTGAAAGAATGG + Intergenic
987467690 5:18291852-18291874 TTTGTTTTCTCCTAATACTTTGG + Intergenic
988221298 5:28349574-28349596 TTTAATTTCTCCTGAAAAAATGG + Intergenic
988536021 5:32069547-32069569 TTTGCTTTCTGCTGAAAATCAGG + Exonic
988876582 5:35453845-35453867 TAAGGTTTCTCCTGAGACTATGG + Intergenic
988905981 5:35789481-35789503 TTTCTTTTCTCCCCAGACTAGGG + Intronic
988914162 5:35875688-35875710 TTTGATTCATCCTGTAACTAGGG + Intronic
989010316 5:36864300-36864322 TATTTTCTTTCCTGAAACTATGG + Intergenic
989602041 5:43209413-43209435 AGTGTTTTCTCCTGAAACAAAGG - Intronic
989602492 5:43212864-43212886 TTTGTTTGCTCTTGAAGTTAGGG - Intronic
990965253 5:61439884-61439906 TTGGTTTTCTCATGAGAATAAGG + Intronic
990978074 5:61576403-61576425 ATTGTTCTCTCCTGTTACTAGGG + Intergenic
992236346 5:74713319-74713341 ATTTTCTACTCCTGAAACTATGG + Intronic
992386750 5:76292029-76292051 TTTGTTTTGTCATAAAGCTAAGG + Intronic
992851209 5:80810834-80810856 TTTGATTTCTTTTGATACTATGG + Intronic
993359802 5:86960515-86960537 ATTGGTTTCTCCTGGAACTGTGG - Intergenic
993534545 5:89066517-89066539 TTTGTTTTCTTCTGTAAATGAGG - Intergenic
993644774 5:90449023-90449045 TTTTTTTTTTCCTGAAACAGGGG + Intergenic
993679857 5:90862894-90862916 TTTGTTTTCTTTTGAAGCTGTGG - Intronic
993966885 5:94369874-94369896 CGTGTTTTATGCTGAAACTATGG - Intronic
993966886 5:94369902-94369924 TGTGTTTTATGCTGAAACTATGG - Intronic
994264519 5:97699550-97699572 TTTGCTTTCTGCTGTAACAAGGG - Intergenic
994712114 5:103278671-103278693 TTTGTTTTTTCCTGAAAGACAGG + Intergenic
995035492 5:107529655-107529677 TTTGTTTTGTGCTGAAGCTATGG + Intronic
995105109 5:108368750-108368772 TTTATTTTCTTCTGACACTGTGG - Intronic
995368462 5:111390660-111390682 TGTTTTTTCTCCTGAAATTATGG + Intronic
995721424 5:115138547-115138569 TTTTTTCTCTTCTGAAAATAGGG + Intronic
996769381 5:127069911-127069933 TGTATTTTCTCCTGGAACAATGG + Intronic
997299146 5:132789677-132789699 TTTTTTTTCTCATGAAACTCTGG - Intronic
997673572 5:135695805-135695827 TTTGTTTACTTCTGAACCCAAGG - Intergenic
998566458 5:143220265-143220287 TTTGATTTTTCCTGAAGCTTAGG + Intronic
998730475 5:145069845-145069867 TGTATTTTCTCCTATAACTATGG + Intergenic
998885131 5:146686208-146686230 TTTGTTCTCTCCTGCAACTCCGG - Intronic
999152144 5:149433342-149433364 TTTTTTTTCCCCTCAAAATATGG - Intergenic
1000815165 5:165912166-165912188 TTTGGTTTCTCCTGAACCATGGG + Intergenic
1000904980 5:166954430-166954452 TTTGTTTTCTTCTAACATTATGG - Intergenic
1001236015 5:170030267-170030289 TTATTTTTCTCCTGAAACAGAGG + Intronic
1001273524 5:170333400-170333422 TCTCTTTTCTCCTGAAAGTCAGG - Intergenic
1001361481 5:171090639-171090661 TTTTTTTTCTCCTAAACCTCTGG - Intronic
1001560244 5:172664287-172664309 CTTGTTTTCTCCTGGAAAAATGG + Intronic
1003089338 6:3088473-3088495 CTTGTGTTCTCCTGACACCATGG + Intronic
1004038798 6:11953378-11953400 TTTGTTTTCCCATAAAACAATGG - Intergenic
1004801466 6:19153165-19153187 TTTGTTTTCTTTTTGAACTAAGG - Intergenic
1005030452 6:21503722-21503744 TTTGTTTTCTCCAGAAGTTGGGG - Intergenic
1005391277 6:25336085-25336107 TTTTTTTTCTCCTGGAAATATGG - Intronic
1006441597 6:34056807-34056829 TTTGTTTTCTCCTGGATCAGAGG - Intronic
1006618270 6:35344190-35344212 TTTGTTCTTTTCTGAATCTAGGG + Intronic
1009435416 6:63612753-63612775 TTTGTTTACAACTGAAACTCTGG + Intergenic
1009741507 6:67752755-67752777 TTTTCTTGCTCCTGGAACTAGGG - Intergenic
1009796502 6:68475851-68475873 TCTTTTTTTTCGTGAAACTAAGG - Intergenic
1009825297 6:68858838-68858860 ATTGTTTTCTCCTGACCCTTTGG + Intronic
1009886537 6:69630086-69630108 TTTTTTTTCTCCTGTAAGTAAGG - Intergenic
1010049756 6:71488940-71488962 TTTTTTTTCTCATGTAACTTAGG + Intergenic
1010375173 6:75160356-75160378 ATTGCTTTCACCTGAAACTCAGG - Intronic
1010767287 6:79790421-79790443 TTAATTTTCTCCTTCAACTAAGG + Intergenic
1011472894 6:87725696-87725718 TCTGTTTTCTGGTGAAGCTATGG + Intergenic
1011572949 6:88759737-88759759 TTTGTTTTTTGCTGTAATTATGG - Intronic
1012636251 6:101546574-101546596 ATTGTTATCCTCTGAAACTAGGG - Intronic
1013159852 6:107532582-107532604 TTTGTTTTCTTCTCATACAAAGG + Intronic
1013934692 6:115579701-115579723 TTTGTTTTTTCCAGACAGTATGG - Intergenic
1014171360 6:118282645-118282667 TTTTATTTCTCCTGAAAATCTGG + Intronic
1014661138 6:124173692-124173714 CTTGTTTTCTCTTGAAAGTAAGG + Intronic
1015606757 6:134964625-134964647 TTTGTATTATGCTCAAACTAAGG + Exonic
1016522329 6:144960282-144960304 TTGGTTGTATCCTGAAACCAGGG + Intergenic
1018424804 6:163670811-163670833 TTTTTTTTTTCCTGAAGGTATGG - Intergenic
1019726161 7:2603767-2603789 TTTGTTTTGTCTTAAAGCTAGGG - Intronic
1019839370 7:3424548-3424570 TTTGTTTTCTGCTGATAGTCTGG + Intronic
1021560485 7:21964588-21964610 TTTGTTTTCTCCTGGAGCTGGGG - Intergenic
1021710802 7:23413829-23413851 TTTGTTTTCTCCCAAATATATGG - Intronic
1021918504 7:25459451-25459473 TTTTTTTTTTCCTGAAATTCTGG - Intergenic
1022073448 7:26941089-26941111 CTTGTCTTCTCCTGAAATTGGGG - Intronic
1022181483 7:27924822-27924844 TTTGTTTTCTGCTAAGACAATGG + Intronic
1023228055 7:37992557-37992579 TTTGCTTTCTGCTGATGCTATGG - Intronic
1023566200 7:41526055-41526077 TTGGTTTTCTCCTCAAAATGAGG + Intergenic
1024134358 7:46391446-46391468 TTTTTTTTTTCCTGTAGCTAAGG - Intergenic
1024304180 7:47913085-47913107 TCTGTTCTCTCCTGTAACCATGG - Intronic
1024490586 7:49977988-49978010 ATTTTTTTCTCTTTAAACTATGG - Intronic
1024528381 7:50369731-50369753 TTTCTTTCCTCCAGCAACTACGG - Intronic
1024568588 7:50705315-50705337 TTTGTTTTCTCCAGATATTCTGG - Intronic
1026136034 7:67661731-67661753 TTTTTTTTGTTCTGAAACAATGG + Intergenic
1026886256 7:73948694-73948716 TTTTTTTTTTCCAGAAAATAGGG - Intergenic
1028432140 7:90759705-90759727 TTTCTTTCCTACTGAATCTAGGG + Intronic
1029214359 7:98935281-98935303 TTTTTTTTCTCCTCAAAACAGGG - Intronic
1029345483 7:99975700-99975722 TTTGTTTTCACTGTAAACTAGGG + Intronic
1029346302 7:99981072-99981094 TTTGTTTTCACTGTAAACTAAGG - Intergenic
1030139731 7:106292277-106292299 GTTTTTTTCTTCTGAAACCAGGG + Intergenic
1030367862 7:108666717-108666739 TTTTGTTTCTCATGAACCTAAGG + Intergenic
1030473365 7:109996999-109997021 TTTTGTTTTTCCTGAAGCTATGG + Intergenic
1030676064 7:112386827-112386849 CTGGTTTACTCCTGTAACTAAGG - Intergenic
1030735344 7:113041624-113041646 TTTTTTTTCTAATTAAACTAAGG - Intergenic
1030985608 7:116238317-116238339 TTTTTAGTCTCCTGCAACTATGG - Intronic
1031182584 7:118436093-118436115 TTTGTTTCTTCCTCAAACCAAGG - Intergenic
1031925751 7:127636729-127636751 TGTGTTTGCTCCTGAATCTAGGG + Intergenic
1032332729 7:130994954-130994976 TTTGTTTGCCCCAGAAACTGTGG - Intergenic
1033066046 7:138155207-138155229 TTTTTTTTCCCCTGATACTCTGG - Intergenic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1035122144 7:156577770-156577792 TTTGTTTTTTCCTTAAAGTCAGG + Intergenic
1035246605 7:157566487-157566509 TTTGATCTCTCCTGAGACTGTGG + Intronic
1036451846 8:8875491-8875513 TTTGTTTCCTCCTTAAGCTTAGG - Intronic
1037267819 8:17086118-17086140 TTTGTTTTCTTTTTAAATTATGG + Intronic
1037967334 8:23145031-23145053 GTTGGTTTCTCCAGAAACTGGGG - Intronic
1039183777 8:34894210-34894232 TTTGTTTTTTCCTCAAAATGGGG - Intergenic
1039386400 8:37139686-37139708 TTTGTATTCTACTAAAAATACGG + Intergenic
1040955542 8:52976233-52976255 TTTCTTTTCTCTTAAAAATATGG + Intergenic
1041109765 8:54473246-54473268 TTTCTTTTCACTTGAAACAAAGG + Intergenic
1042506847 8:69569899-69569921 TTTTTTTTCTACCCAAACTATGG - Intronic
1043386310 8:79751153-79751175 GATGCTTTCTTCTGAAACTATGG - Intergenic
1043609782 8:82048383-82048405 TTTGTTTTTTCCTCTATCTAAGG + Intergenic
1043868418 8:85401784-85401806 TTTTCTTAATCCTGAAACTATGG - Intronic
1044284236 8:90392966-90392988 TTTGTTTTCTCCCAAAAGAAGGG - Intergenic
1044401784 8:91781337-91781359 TTTGTTTTGTCTTGAAACTAGGG - Intergenic
1044411364 8:91887377-91887399 TTTGTATACTCCTGGAGCTAGGG - Intergenic
1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG + Intronic
1045331574 8:101159923-101159945 TTTGTTTTTTCCTGAATTTTGGG - Intergenic
1046544707 8:115635291-115635313 TTTTTTTTCCCCAGAAACCAAGG + Intronic
1047106690 8:121739279-121739301 TTTGTTTTCTCCTGTAAAACAGG - Intergenic
1047310226 8:123685745-123685767 TTTCTTTTCCACTGAAACTGTGG - Intronic
1048312697 8:133337997-133338019 TTTGTTTTGTTCTTAAACTGGGG - Intergenic
1048834277 8:138503453-138503475 TTTGTTTTTTGTAGAAACTAGGG - Intergenic
1050070984 9:1813901-1813923 TTTTTTTTCTTCTGAAAGCATGG - Intergenic
1050497300 9:6257483-6257505 TTTGTTTTTTACTGTCACTAGGG + Exonic
1051198492 9:14589707-14589729 TTAGTTTTATCCTATAACTAAGG - Intergenic
1051872126 9:21750040-21750062 TTTGTTTTCTTATGACATTATGG + Intergenic
1051933495 9:22414891-22414913 TTTGTTTTCTCTTGTACTTATGG + Intergenic
1052681883 9:31703653-31703675 TTTGTTTTATCTTTAAAATAGGG - Intergenic
1053336964 9:37283315-37283337 TTTGTTTTCTCCTGAAACTATGG - Intronic
1053440916 9:38115707-38115729 CATGCTTTATCCTGAAACTATGG - Intergenic
1055410775 9:76027083-76027105 TTTGTTTTCTGCTCATACTGAGG + Intronic
1055605958 9:77970729-77970751 TTTGTTTTCTCTTGAGTCTATGG - Intronic
1056772416 9:89488711-89488733 TGTGTTTTCTTCTGAAAATGTGG - Intronic
1058228205 9:102393131-102393153 TTTCTTTTCTTCTTAAAATATGG - Intergenic
1058429241 9:104903616-104903638 TTTGTCTTCTTCTGAAAGTGAGG + Exonic
1059218139 9:112586059-112586081 TTTGTTTTGTTTTTAAACTAGGG - Intronic
1059462194 9:114439366-114439388 TTTATTTTGTCCTTAAACTGAGG - Intronic
1061356226 9:130107239-130107261 TTTGTTTTCTCCTCACGCTCTGG + Intronic
1061922506 9:133789699-133789721 TTTGTTCTCTCCTGAACGTGGGG - Intronic
1186381325 X:9063001-9063023 TTTGTTTTTTATTGAAAATAAGG + Intronic
1187379937 X:18792520-18792542 TTTTTTTTCTCCTGAAAGTTTGG + Intronic
1187971901 X:24667282-24667304 TTTGTCTCCTTCAGAAACTAAGG - Intronic
1188573216 X:31614523-31614545 TTTGTTTGCTCCTGAGTCTGTGG - Intronic
1188871228 X:35375662-35375684 TATGTTTTCTCCTGAATCTGTGG - Intergenic
1189833901 X:45001739-45001761 AGTGTTTTCCCCTGAGACTATGG + Intronic
1190051507 X:47153427-47153449 TTTTTTTTTTCCTGAACCTATGG + Intronic
1190272517 X:48877195-48877217 GGTGTTTTCATCTGAAACTAGGG + Intergenic
1190834872 X:54091227-54091249 TTTTTTTTTTCCTGAAGCTGAGG - Intronic
1192082516 X:68062054-68062076 TTTGTTTTCTCTAGAAAGTTTGG + Intronic
1193399112 X:81021206-81021228 TTTGTTTTCTCCTCAGCCTGAGG + Intergenic
1193731810 X:85111041-85111063 TTTGTTTTCTTCTGAAATGCAGG + Intergenic
1193744569 X:85260389-85260411 TTTTTTTACCCCTGAAATTAGGG - Intronic
1193749397 X:85324500-85324522 TCTGTTTTTTTCTGAAATTAGGG + Intronic
1194007036 X:88507461-88507483 TTTCTTTTAACCTGTAACTAAGG - Intergenic
1194494575 X:94597089-94597111 GTTATTCTCTTCTGAAACTAAGG + Intergenic
1194581611 X:95679125-95679147 TTTGTTTACAACGGAAACTATGG + Intergenic
1194821035 X:98507592-98507614 TTATTTCTCTCCTGAAACTCTGG + Intergenic
1194824369 X:98543179-98543201 TGTTTTTTCTTCTGAAAATATGG - Intergenic
1195225160 X:102784989-102785011 TTTGCTTTCTGCTGTAACAAGGG + Intergenic
1195348136 X:103971757-103971779 CTGATTTTCTCCTGAAACCACGG - Intergenic
1195359306 X:104067084-104067106 CTGATTTTCTCCTGAAACCACGG + Intergenic
1195594640 X:106673921-106673943 TTTGCTTTCTGCTGTAACAAGGG + Intronic
1196172222 X:112602108-112602130 TTTTTTTTTTTCTGAAACTCTGG - Intergenic
1197876640 X:131115449-131115471 TTTGCTTTCTCCTATAACAAGGG + Intergenic
1197960200 X:131995832-131995854 TTTGTTTTCTTCTGACTCCATGG + Intergenic
1198422815 X:136484785-136484807 TTTTTTTTTTCCTGATACTGAGG - Intergenic
1198707884 X:139468993-139469015 ATTGTGTTCTCCTGAAATTTTGG + Intergenic
1200533523 Y:4364282-4364304 TTTGTTTGTTTCTGAAATTAGGG + Intergenic
1201643057 Y:16199552-16199574 TTTCTGTTCTTCTGATACTACGG + Intergenic
1201643248 Y:16200858-16200880 TTTGCCTTCTCCAGAAACTTGGG + Intergenic
1201659567 Y:16384463-16384485 TTTGCCTTCTCCAGAAACTTGGG - Intergenic
1201659758 Y:16385769-16385791 TTTCTGTTCTTCTGATACTACGG - Intergenic
1201981055 Y:19910786-19910808 TTTGCTTTCTCCTGAATAAAGGG - Intergenic