ID: 1053337340

View in Genome Browser
Species Human (GRCh38)
Location 9:37287032-37287054
Sequence CTGTTTCAACAACAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053337340_1053337343 12 Left 1053337340 9:37287032-37287054 CCTCTCTGCTGTTGTTGAAACAG 0: 1
1: 0
2: 3
3: 16
4: 290
Right 1053337343 9:37287067-37287089 TCATCCAGGCTGAAGTGCAGTGG 0: 187
1: 8264
2: 100660
3: 186269
4: 210914
1053337340_1053337341 -2 Left 1053337340 9:37287032-37287054 CCTCTCTGCTGTTGTTGAAACAG 0: 1
1: 0
2: 3
3: 16
4: 290
Right 1053337341 9:37287053-37287075 AGAGCCTCTCTCTTTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053337340 Original CRISPR CTGTTTCAACAACAGCAGAG AGG (reversed) Intronic
900033852 1:390850-390872 CTGTGTCAACAACCTGAGAGTGG + Intergenic
900054687 1:620740-620762 CTGTGTCAACAACCTGAGAGTGG + Intergenic
901719672 1:11186513-11186535 CTCTTTCAACACCAGCAAAATGG + Intronic
906235800 1:44208435-44208457 CTGTCTCAACAACAACAAACAGG - Intergenic
908251282 1:62267941-62267963 CTGTTTCCACAACTGTAGAGTGG + Intronic
909731778 1:78900598-78900620 CTGTCACAAGAACAGCAAAGGGG - Intronic
910247668 1:85158401-85158423 CTGTCTCAGCTACAGAAGAGTGG + Exonic
910836290 1:91516069-91516091 CTGTTTAAACAAAAAAAGAGAGG - Intronic
911017920 1:93354604-93354626 CTGTTTCAAAAAGAGAAGGGAGG + Intronic
911507676 1:98773854-98773876 CAGTTTCAGCAACATCTGAGGGG + Intergenic
911540493 1:99151815-99151837 CTATTACAAGAACAGCAAAGGGG + Intergenic
913260169 1:116990658-116990680 GTGTTTCCTCAACTGCAGAGAGG - Intergenic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916965663 1:169939804-169939826 CTGTGTCAAAACCAGCTGAGAGG + Intronic
917018116 1:170557616-170557638 CTCTTCCACCAACAGCATAGTGG - Intergenic
919174946 1:194008598-194008620 CTATCACAAGAACAGCAGAGGGG - Intergenic
919526732 1:198662915-198662937 CAGTTACATCAACTGCAGAGAGG - Intronic
919597906 1:199587429-199587451 GTGTTTCAATACCAACAGAGTGG + Intergenic
921539711 1:216398808-216398830 CTGTTTCAACAAGTGGAGAATGG - Intronic
921661740 1:217810863-217810885 CTGTCACAAGAACAGCATAGGGG + Intronic
922256209 1:223895006-223895028 CTGTGTCAACAACCTGAGAGTGG + Intergenic
922277241 1:224090365-224090387 GTGTTTGAAAAACAGCATAGAGG - Intergenic
923456935 1:234172908-234172930 ATGTTGCAAAAATAGCAGAGAGG + Intronic
923499945 1:234556245-234556267 CTGTTTCAAGAACATCAGGCCGG - Intergenic
924337415 1:242997872-242997894 CTGTGTCAACAACCTGAGAGTGG + Intergenic
1063145326 10:3290550-3290572 CTGTGTCAACACCAGCAGGCAGG - Intergenic
1064130996 10:12709383-12709405 TTGTTTCAACAATGGCAAAGAGG - Intronic
1065653521 10:27920894-27920916 ATGTTTAAACCACAGAAGAGAGG + Intronic
1067415174 10:46097241-46097263 CTGTTTTAACAGCAGCTGACAGG - Intergenic
1068033524 10:51732062-51732084 CTGTTTCAACAAAAACAAAAGGG - Intronic
1068637819 10:59367444-59367466 CTGTTATAATAACAGGAGAGAGG - Intergenic
1068806551 10:61201122-61201144 ATGTTTCAACCACAGTATAGTGG - Intergenic
1069117817 10:64529903-64529925 CAGTTTCATCAATAGCGGAGTGG + Intergenic
1069259204 10:66372818-66372840 CTGTCACAAGAACAGCATAGGGG + Intronic
1071103876 10:82071525-82071547 GTGTTTGAATAACAGCAGAAGGG + Intronic
1072127367 10:92458800-92458822 CTGTTTCAAAAAAAAGAGAGAGG - Intronic
1072697422 10:97614167-97614189 CTTTTTCTGCAACAGGAGAGTGG - Intronic
1073286256 10:102390863-102390885 CTGTCTCAAAAAAAGAAGAGTGG - Intergenic
1074271627 10:111959319-111959341 ATGTTTGAACAAAAACAGAGAGG + Intergenic
1075223428 10:120603732-120603754 CGGTTTCAAAACCAGCTGAGCGG + Intergenic
1075680556 10:124328134-124328156 CTGGTTCAAGTACAGCAGAAAGG - Intergenic
1075763670 10:124876003-124876025 CAATTTCTACACCAGCAGAGAGG - Intergenic
1080843213 11:36003958-36003980 CTGTCACAAAAACAGCAAAGGGG + Intronic
1083262414 11:61530452-61530474 CTGTTTTTACATCTGCAGAGTGG + Intronic
1084402251 11:68951337-68951359 CTGTTTAATGAACAGCGGAGAGG + Intergenic
1085723951 11:78937790-78937812 TTGTTTAAATTACAGCAGAGGGG - Intronic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1087656672 11:100931992-100932014 CTGTTTGAACAAGAGAAGAAAGG + Intronic
1088601248 11:111478126-111478148 CTGATTCCACTACAGCAGGGAGG - Intronic
1089201221 11:116725785-116725807 CTGTTTCCCCACCTGCAGAGTGG + Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1090713646 11:129411068-129411090 GTGTTTAAAGAATAGCAGAGTGG + Intronic
1091097694 11:132839621-132839643 CAGCGTCAACAACAGCAGTGTGG - Intronic
1091276688 11:134357566-134357588 CTGAGTCAACAACCGCTGAGAGG - Intronic
1091296806 11:134479677-134479699 CAGATTCAACAGCAGAAGAGTGG + Intergenic
1092188751 12:6501843-6501865 GTGTTTCAAAAACAAAAGAGAGG + Intronic
1093341210 12:17976209-17976231 CTGTTGCAACATCAGGAGAGCGG + Intergenic
1095776017 12:46010962-46010984 CTATTACAAGAACAGCATAGGGG - Intergenic
1096587551 12:52632616-52632638 CCGTCTCAAAACCAGCAGAGTGG + Intergenic
1096969827 12:55656820-55656842 CAGTTTCCTCATCAGCAGAGTGG - Intergenic
1099765797 12:86981746-86981768 CTGTCACAAGAACAGCATAGTGG - Intergenic
1100103618 12:91141299-91141321 ACGTTCCAACAAGAGCAGAGAGG - Exonic
1101100145 12:101383234-101383256 CTGGATCAACCACAGCAGCGTGG - Exonic
1101693110 12:107099133-107099155 CTGTTTCTTCAACAGCAAACTGG - Intergenic
1102917392 12:116764580-116764602 CTGTTTTAACAACAGCAGAAAGG - Intronic
1103736026 12:123061370-123061392 CTGTTTCCTCATCTGCAGAGTGG - Intronic
1104196459 12:126543756-126543778 CTGGTGCAGCAACACCAGAGGGG + Intergenic
1105705375 13:22964859-22964881 CTTTTTAACCAAGAGCAGAGAGG - Intergenic
1106969831 13:35126130-35126152 CTATTACAAGAACAGCAGGGGGG - Intronic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1108695498 13:52899289-52899311 CTCATTCCAAAACAGCAGAGAGG - Intergenic
1108985559 13:56582127-56582149 CTGATACAACAACAGCAATGAGG + Intergenic
1109710062 13:66147304-66147326 CTATTTCAACAACACTTGAGTGG + Intergenic
1110160790 13:72375918-72375940 GTGTTTGAGTAACAGCAGAGAGG + Intergenic
1110802515 13:79715645-79715667 CTATTACAAGAACAGCATAGGGG + Intergenic
1111246379 13:85547338-85547360 CTGTCACAAGAACAGCAAAGGGG + Intergenic
1112971983 13:105272892-105272914 CTATTACAAGAACAGCAAAGGGG + Intergenic
1114265023 14:21068947-21068969 CTGTTCCAACAACTGCCCAGAGG + Intronic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1115771614 14:36667687-36667709 CTATTTCAACAAAATAAGAGAGG - Intronic
1117294535 14:54366862-54366884 CTCTTTCAACCACAGGAGAAAGG + Intergenic
1119863769 14:77956248-77956270 CTGTTTCTCCAAGAGAAGAGAGG + Intergenic
1120450207 14:84657087-84657109 TACTTTCAACAACAGCAGAACGG - Intergenic
1120743157 14:88129986-88130008 CTCTGTCATCAACAGAAGAGAGG + Intergenic
1121398198 14:93646705-93646727 CTGTTTCTAAAACACCAGTGTGG + Intronic
1121897656 14:97663464-97663486 ATGTTTCAGCTACAGGAGAGAGG + Intergenic
1122502147 14:102207926-102207948 CTCTCTCAACACCAGCAGAGAGG + Intronic
1123134769 14:106017745-106017767 CTGTTTCAATCACAGCAGGATGG - Intergenic
1123135929 14:106027302-106027324 CTGTTTCAATCACAGCAGGATGG - Intergenic
1123583564 15:21737776-21737798 CTGTTTCAATCACAGCAGGATGG - Intergenic
1123620214 15:22180379-22180401 CTGTTTCAATCACAGCAGGATGG - Intergenic
1125206693 15:37161487-37161509 CTATTTCAAGAACAGCATGGGGG - Intergenic
1126824931 15:52539596-52539618 CTGTTGCAAGAACAGCATGGGGG + Intergenic
1127311022 15:57752551-57752573 CAGGTTCATCCACAGCAGAGGGG + Intronic
1128678889 15:69632094-69632116 CTGTTTCCGCATCTGCAGAGAGG + Intergenic
1131265485 15:90912835-90912857 CTGTTGAAACTACAGCACAGAGG - Intronic
1131570930 15:93535396-93535418 CTGTTTCAAGAGTAGCAGTGGGG - Intergenic
1131934050 15:97482215-97482237 TTGTTTCAACAATAGCAAATTGG + Intergenic
1135476669 16:22782524-22782546 CTGTTACAACAACCCCAGAAGGG + Intergenic
1135824707 16:25716434-25716456 CCCTTTCACCAACAGCAAAGAGG - Intronic
1135875247 16:26193126-26193148 CTATGGCAACAACAGAAGAGAGG + Intergenic
1136291200 16:29272512-29272534 CTCATCCAACAAAAGCAGAGAGG + Intergenic
1137501321 16:49013634-49013656 CTGTTTTAGCAACAAAAGAGTGG + Intergenic
1139092464 16:63665056-63665078 CTCTTTCATCAACAGCAGGGAGG - Intergenic
1139324066 16:66138235-66138257 CTATTGAAATAACAGCAGAGAGG + Intergenic
1139841055 16:69881052-69881074 ATGTTTCACCAACATCACAGAGG + Intronic
1141089492 16:81120587-81120609 CTCTTTCAACAACAGGAGAAAGG - Intergenic
1141111861 16:81276440-81276462 CTGTGGCAGGAACAGCAGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142097070 16:88245973-88245995 CTCATCCAACAAAAGCAGAGAGG + Intergenic
1143384891 17:6523312-6523334 CTGTTTCTTCATCTGCAGAGTGG - Intronic
1146933471 17:36794599-36794621 CTCTTTCCACCACAGCACAGTGG + Intergenic
1147359949 17:39924213-39924235 TTGTTTGCAGAACAGCAGAGAGG - Exonic
1147555144 17:41473919-41473941 CTGTTTCAACAAAAGCAGATAGG + Intergenic
1152235395 17:79135765-79135787 CTGTCTTAGCCACAGCAGAGGGG - Intronic
1153638604 18:7135091-7135113 CTCTTTCAACAACAGCTGTATGG + Intergenic
1154280211 18:12995894-12995916 ATGTTTCAGGAACAGCAGGGAGG + Intronic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1157713929 18:49869493-49869515 CTAAGTCAACAGCAGCAGAGTGG + Intronic
1158403204 18:57139585-57139607 CTGTGTCACCAACAGCAGGCGGG + Intergenic
1158963005 18:62601823-62601845 GTGTTTCTAGAACAGCAAAGGGG + Intergenic
1161637329 19:5397041-5397063 CTGTTTCCACATCACCACAGTGG + Intergenic
1163917921 19:20258848-20258870 CCGTTTCAAAATCAGCAGAGTGG - Intergenic
1165263637 19:34642037-34642059 CAGCTTCCAAAACAGCAGAGTGG - Intronic
1165437481 19:35804118-35804140 CTCCTTCAACTACAGCATAGGGG + Intronic
925147953 2:1593610-1593632 CTGTGACAACCACAGCAGATGGG - Intergenic
925513443 2:4653091-4653113 CTGTTTCAAGGCCAGCAAAGGGG - Intergenic
925660225 2:6194485-6194507 CTGTCACAAAAACAGCATAGGGG - Intergenic
926008023 2:9387962-9387984 CTATCCCAAGAACAGCAGAGGGG + Intronic
927827189 2:26317050-26317072 CTGATTCTACAGGAGCAGAGGGG + Exonic
927952466 2:27181658-27181680 ATGTTTCAAGACCAGCACAGTGG + Intergenic
928138779 2:28709562-28709584 CTGTGGCAATAACAGCAGAAAGG - Intergenic
929472138 2:42204461-42204483 ATTTTACAAAAACAGCAGAGAGG - Intronic
929711745 2:44273312-44273334 CTGTCTCAACAACAACAAAAAGG - Intergenic
930181946 2:48369081-48369103 CTGTTTCTATAACAGTAGAATGG - Intronic
930294078 2:49531271-49531293 CTATCACAAGAACAGCAGAGGGG + Intergenic
930960260 2:57252495-57252517 CTATCACAAGAACAGCAGAGGGG + Intergenic
931434695 2:62236289-62236311 CTGTTCCAGCCTCAGCAGAGGGG - Intergenic
931742070 2:65255574-65255596 CCGTTTCAAAATCAGCAGAGTGG - Exonic
935419565 2:102853454-102853476 CTGTTTCAAAACCATCAGATTGG + Intergenic
936070212 2:109364712-109364734 CTGTTTCACCTACAGAGGAGTGG - Intronic
936754646 2:115692657-115692679 CTGTTTTAACAACAGCTGGTTGG + Intronic
937415662 2:121712563-121712585 CAGTTTCAAAAACAGCTGGGGGG + Intergenic
939875527 2:147573217-147573239 GTGTTTCAACAAGGGGAGAGAGG - Intergenic
941089955 2:161163172-161163194 CTATTTAAACTACATCAGAGCGG - Intronic
941798515 2:169628190-169628212 CTGGTACATCAACAGCATAGAGG + Intronic
942069573 2:172304253-172304275 CTGTTTGAACAAAAGCACACAGG + Intergenic
943104559 2:183528584-183528606 CTATCACAAGAACAGCAGAGGGG - Intergenic
943786784 2:191886163-191886185 CTTCATCACCAACAGCAGAGGGG - Intergenic
944006105 2:194908456-194908478 CTGTTTCAAGAGCACCAGAGTGG + Intergenic
945465027 2:210159215-210159237 GTGTTTCAAATACAGCATAGAGG - Intronic
945964396 2:216170543-216170565 CTGTCACAAGAACAGCAAAGGGG + Intronic
946581200 2:221129730-221129752 CTGTTTCAACAAGATCTGAATGG + Intergenic
947254242 2:228143977-228143999 CTGTTTTAGGAACAGCAGAGAGG - Intronic
948918863 2:241052201-241052223 CTGTTTTCACATCTGCAGAGAGG - Intronic
1172060783 20:32185973-32185995 GTGTTTAAAGAACAGGAGAGAGG + Intergenic
1172581450 20:36051588-36051610 CTGTTCCAGGAACAGCAAAGAGG + Intergenic
1172629636 20:36369239-36369261 CTGGTTGAATCACAGCAGAGTGG + Intronic
1172730394 20:37082211-37082233 CTGTATCATCACCAGCAGGGGGG - Intronic
1173363779 20:42367323-42367345 CTGAATCTACAACATCAGAGAGG + Intronic
1173542611 20:43865855-43865877 CTATTTCATAAACATCAGAGTGG - Intergenic
1173664216 20:44753557-44753579 CTGTTTGAAGAGGAGCAGAGAGG - Intronic
1174173486 20:48630955-48630977 CTGTTCCTACAACAGCCGGGGGG + Intronic
1174600349 20:51719249-51719271 CACCTTCAACAAGAGCAGAGAGG + Intronic
1174643206 20:52063084-52063106 TTTTTGCTACAACAGCAGAGTGG + Intronic
1177008454 21:15702626-15702648 ATATTTAAACAACAGCAGTGTGG - Intergenic
1177668170 21:24188852-24188874 CAGTTTCCAGAAGAGCAGAGTGG - Intergenic
1181164064 22:20974106-20974128 CTGCTTCAACATCAGCACTGGGG + Exonic
1181710887 22:24687532-24687554 CCGTTTCAAAATCAGCAGGGTGG - Intergenic
1182207384 22:28642691-28642713 ATGTTTCAGAAACAGCAAAGAGG + Intronic
1182943053 22:34296612-34296634 TTCTTTCAATAACAGTAGAGAGG + Intergenic
1183486739 22:38091569-38091591 CGGTTTCAAAACCATCAGAGAGG + Intronic
1184363337 22:44031835-44031857 CTGTGCCAACCACAGCAGGGAGG - Intronic
1184782915 22:46658086-46658108 CTGACTCAGAAACAGCAGAGGGG - Intronic
949695282 3:6687329-6687351 CTGTTTCATCATGAGCAGAGAGG + Intergenic
950143758 3:10633332-10633354 CTGATGCAATAACAGCAGACAGG + Intronic
954350260 3:50037399-50037421 CTGTCTCAAAAAAAGCAGGGGGG + Intronic
954774125 3:53000323-53000345 ATGTTTCAACAACAACAAAGAGG + Intronic
954908678 3:54085194-54085216 CTATCTCAACCATAGCAGAGGGG - Intergenic
955565982 3:60246795-60246817 TTGCTTCAACTGCAGCAGAGAGG - Intronic
957515764 3:81249070-81249092 CTGTTACAATAAGAGCATAGGGG - Intergenic
957715926 3:83929405-83929427 CTATCTCACCAACAGCAGAATGG + Intergenic
958192607 3:90202243-90202265 ATGTTTCAATAACAGCTGAAGGG - Intergenic
958416026 3:93874172-93874194 ATGTTTCAATAACAGCTGAAGGG - Exonic
959099311 3:101992202-101992224 CTGTCACAAGAACAGCACAGGGG - Intergenic
960399515 3:117179246-117179268 CTGTTTCCACAGCTGCAGAATGG + Intergenic
960498812 3:118410124-118410146 CTGTTACAAGAACAGCAAGGGGG - Intergenic
960913567 3:122674618-122674640 CTGTCACAAAAACAGCAAAGGGG + Intergenic
962563034 3:136628112-136628134 CTATCACAACAACAGCATAGAGG - Intronic
962682403 3:137814062-137814084 CTGTTTCAACAACAACAACTGGG - Intergenic
964102684 3:153006025-153006047 CTGTATCAACTTCTGCAGAGGGG - Intergenic
971632369 4:29010091-29010113 CAGTTTCAACAACAGCTGGAAGG + Intergenic
971650990 4:29273806-29273828 ATGTTGCAATAATAGCAGAGAGG - Intergenic
971896557 4:32604702-32604724 CTGTCACAAGAACAGCAAAGGGG + Intergenic
973342362 4:49018182-49018204 CTATTACAACAACACCAAAGGGG + Intronic
974995608 4:69155781-69155803 ATGTTTACACACCAGCAGAGAGG - Intronic
975428587 4:74259863-74259885 CTGTTTCAACAATACCTTAGGGG - Intronic
975500721 4:75081340-75081362 CTTTATCCACAAGAGCAGAGTGG + Intergenic
976505249 4:85838680-85838702 CAGTTTCAGCAACAGAAGTGGGG - Intronic
979239717 4:118437436-118437458 CTGTGTCAACAACCTGAGAGTGG - Intergenic
979261373 4:118650007-118650029 CTGTCACAAGAACAGCACAGGGG - Intergenic
979595913 4:122533674-122533696 CTGTCTCAACAACAAAAAAGAGG + Intergenic
981940563 4:150277801-150277823 GGGTTTCAAAAACTGCAGAGGGG - Intronic
984213938 4:176884388-176884410 CTGTCTCCACAACATCAGAGAGG - Intergenic
985072042 4:186175910-186175932 ATGTCTGAAGAACAGCAGAGAGG + Intergenic
985277588 4:188253068-188253090 CTCTATCAACGTCAGCAGAGTGG - Intergenic
985948907 5:3208064-3208086 CAGTGTAATCAACAGCAGAGGGG + Intergenic
992157989 5:73973440-73973462 ATGTGACAACAAAAGCAGAGAGG + Intergenic
992480210 5:77143741-77143763 GAGTTTAAACAGCAGCAGAGGGG + Intergenic
993005572 5:82425203-82425225 CTTTTACAAGAACAGCAGTGAGG + Intergenic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
995417872 5:111930165-111930187 CTGATTTAGCAAGAGCAGAGGGG + Intronic
995585809 5:113646954-113646976 CTGTTTCAAAAAAAGAAAAGTGG + Intergenic
996696289 5:126399430-126399452 CTATTACAAGAACAGCACAGGGG - Intronic
997019994 5:129988883-129988905 CTGTACCAACATCATCAGAGGGG + Intronic
998788941 5:145744660-145744682 CAGTATCAACAACAACAGAAAGG + Intronic
999275713 5:150328764-150328786 CTTTTCCACAAACAGCAGAGAGG + Intronic
999766178 5:154742517-154742539 CTGTTCCAACAACAGTGCAGTGG - Intronic
999843911 5:155457667-155457689 CTATTACAAGAACAGCATAGGGG - Intergenic
1000660272 5:163929793-163929815 CTGTCACAAGAACAGCATAGGGG - Intergenic
1002739968 5:181428018-181428040 CTGTGTCAACAACCTGAGAGTGG - Intergenic
1002935954 6:1672662-1672684 CTGTTTCATCACCACCAGACTGG + Intronic
1003800813 6:9664895-9664917 CTGTTACAAGAACAGCATGGGGG - Intronic
1004913430 6:20308460-20308482 GTGTTTGAACAACAGCAAACAGG - Intergenic
1006196727 6:32247564-32247586 CTGCTTCCAGAAGAGCAGAGTGG - Intergenic
1008278172 6:49565076-49565098 CTGTCTCAACAACAACAAAAAGG - Intergenic
1011848796 6:91600653-91600675 CTGTCACAAAAACAGCAAAGGGG - Intergenic
1012864324 6:104599420-104599442 CTGTTTCAAGAAAGGCAGTGAGG + Intergenic
1013193331 6:107822850-107822872 CTGTTTGAGCAACAGCAGCTGGG - Intronic
1013960451 6:115892832-115892854 CTGTGTAAGCCACAGCAGAGCGG + Intergenic
1015457783 6:133448123-133448145 CTGTTTTAAACACAGCAGACTGG + Exonic
1016447868 6:144151104-144151126 CTGTGTCAAAAACACCAGAATGG + Intronic
1016920640 6:149289647-149289669 TTTTTTCATCAACAGCAGTGAGG - Intronic
1016940257 6:149477451-149477473 CAGTTTCAAAAGCGGCAGAGAGG - Intronic
1016952984 6:149599222-149599244 CTTTTTCAACAAATGGAGAGAGG + Intronic
1019245080 6:170703618-170703640 CTGTGTCAACAACCTGAGAGTGG - Intergenic
1020288312 7:6703380-6703402 CTATTTTTACAACAGCAGGGAGG + Intronic
1020857926 7:13452066-13452088 CTATCACAAGAACAGCAGAGGGG - Intergenic
1022488892 7:30801444-30801466 CTGTATCCACCACAGAAGAGAGG - Intronic
1022736509 7:33081209-33081231 CTGTTTCCAGAAGAGCAGAGTGG - Intergenic
1025093776 7:56082585-56082607 CTGTTTCAAAAAAAAAAGAGAGG + Intronic
1025985975 7:66452224-66452246 CTGTTTCAAAAACAGAGTAGAGG - Intergenic
1026029026 7:66773279-66773301 CTGTTTCAAAAACAGAGTAGAGG + Intronic
1026103764 7:67404412-67404434 CTGTTCCGAGACCAGCAGAGAGG + Intergenic
1027506493 7:79021935-79021957 CTGTCACAAAAACAGCATAGGGG - Intronic
1027773876 7:82442576-82442598 CTATTTCCAGAACAGCAGCGAGG + Intronic
1027775412 7:82458674-82458696 CTGTCTCAAGAACAGCAAGGGGG + Intergenic
1028514752 7:91664815-91664837 CTGTTTCACCAACAGAAGCAAGG + Intergenic
1029493515 7:100884900-100884922 CTGTGTGAGCCACAGCAGAGGGG - Intronic
1029868011 7:103656894-103656916 CTGTTTCACTATCAGCAAAGTGG - Intronic
1030146164 7:106358279-106358301 CTCTTACAACCACAGCACAGAGG - Intergenic
1030712905 7:112773391-112773413 CTGTTTCAAGAACATCTGGGTGG + Intronic
1030909537 7:115229503-115229525 CTGTTCAAACCACATCAGAGCGG - Intergenic
1031665655 7:124479732-124479754 CAGTTTCCACAATATCAGAGAGG + Intergenic
1031685157 7:124724486-124724508 CTATTTCTACATCAGTAGAGTGG - Intergenic
1032423454 7:131801620-131801642 CTGTCACAAGAACAGCAAAGGGG - Intergenic
1032595007 7:133230909-133230931 TTGTTTCAGCATCAACAGAGTGG - Intergenic
1033812883 7:145037443-145037465 CTGTTCTAACAATAGCAGACTGG - Intergenic
1035465282 7:159071257-159071279 CAGTTTCAAGAACTGCACAGAGG + Intronic
1035503043 8:104584-104606 CTGTGTCAACAACTTGAGAGTGG + Intergenic
1035644359 8:1206822-1206844 CTGTGTCAGCGACAGAAGAGGGG - Intergenic
1037008964 8:13817920-13817942 CTGTTACAGCAACAGCAAAATGG - Intergenic
1037407581 8:18559887-18559909 CTGTTTCTACAGCAGCATAAAGG + Intronic
1038646818 8:29368994-29369016 CTGTCTGAACAACAGCAAGGAGG + Intergenic
1038928553 8:32167865-32167887 CTGTTTCAAAAAGAGCAAGGTGG - Intronic
1040914990 8:52559637-52559659 CTGTTTCAGAACCAGCTGAGAGG - Intronic
1041213662 8:55578545-55578567 CTGTTTCACCATCAGCAAAATGG - Intergenic
1042365504 8:67931989-67932011 CTGTTTTAACAACACTATAGAGG + Intergenic
1043667805 8:82839478-82839500 ATGTTGCAGAAACAGCAGAGAGG - Intergenic
1045454723 8:102366434-102366456 CTGTATCCAGAAAAGCAGAGGGG - Intronic
1046708423 8:117481276-117481298 CTTTCACAACAACAGCAAAGTGG - Intergenic
1047371824 8:124262274-124262296 CTGTTTCAACAAGACCGCAGGGG - Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1047823440 8:128547608-128547630 CTGGTTCACCAACAGCAAGGAGG - Intergenic
1047884721 8:129236465-129236487 CTATTACAATAACAGCATAGAGG - Intergenic
1048343116 8:133555771-133555793 CCGTTCCAACAGCAGCAGTGAGG - Intronic
1048930068 8:139307852-139307874 CTATTTCAAAAACAGCACTGTGG - Intergenic
1049777865 8:144414781-144414803 CTGCTCCAACAGCAGCTGAGTGG - Exonic
1052473455 9:28929043-28929065 CAAATTCAACAAAAGCAGAGGGG + Intergenic
1053319656 9:37084705-37084727 CAGTTTTAACAACAGCATATAGG - Intergenic
1053337340 9:37287032-37287054 CTGTTTCAACAACAGCAGAGAGG - Intronic
1056216087 9:84407450-84407472 CTGATTCAACTAAAGTAGAGCGG + Intergenic
1056427213 9:86489096-86489118 CTGCTTCACCATCAGCAGAGAGG + Intergenic
1057173386 9:92976948-92976970 CAGTTTCCACAACTGCACAGTGG + Intronic
1057685949 9:97234870-97234892 CTGTTGCTACGACAGCATAGTGG + Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1058833793 9:108842763-108842785 CTGTAACAAGAAGAGCAGAGGGG + Intergenic
1060848096 9:126853122-126853144 CTGGGTCAACATCAGCAGAGAGG + Intergenic
1203605275 Un_KI270748v1:52826-52848 CTGTGTCAACAACCTGAGAGTGG - Intergenic
1186173935 X:6905568-6905590 CTGTCCCAAGAACAGCATAGGGG + Intergenic
1187701855 X:21970431-21970453 CTCCTTCACCAGCAGCAGAGAGG - Intronic
1188106217 X:26150380-26150402 CTTTTTCTACACCAGGAGAGAGG + Intergenic
1188440920 X:30215001-30215023 CCCTTGCAACACCAGCAGAGGGG + Intergenic
1189275082 X:39779536-39779558 CTGTTTCAAGATCCTCAGAGGGG + Intergenic
1190405837 X:50086738-50086760 CCGTTTCAACACAAGCAAAGGGG + Exonic
1190942391 X:55054968-55054990 TTTTTTCAACCACAACAGAGAGG + Intergenic
1191054549 X:56228718-56228740 CTGGTTCAACATTAGCGGAGGGG + Intergenic
1191777420 X:64830843-64830865 ATCTTTCAACACCATCAGAGTGG + Intergenic
1193241513 X:79175741-79175763 CTGTTTTGAGAAGAGCAGAGGGG - Intergenic
1193565857 X:83076286-83076308 CTATTACAACAACAGCAAGGGGG + Intergenic
1195005441 X:100681058-100681080 CTGTTTGAAAAAACGCAGAGAGG + Intronic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1198393747 X:136202358-136202380 CTGTCTCAACAACAACAAAGAGG + Intronic
1199032565 X:143017415-143017437 CTATCACAAGAACAGCAGAGGGG - Intergenic
1199567545 X:149231048-149231070 TTGTTTGCAGAACAGCAGAGGGG - Intergenic
1199890328 X:152072615-152072637 CAGTTTGAACAAGAGAAGAGAGG + Intergenic
1200410999 Y:2861548-2861570 CAGTTGTTACAACAGCAGAGAGG - Intronic
1201617083 Y:15912580-15912602 CTGTCACAAGAACAGCATAGAGG - Intergenic
1202387458 Y:24339266-24339288 CTGTGTCAACAACCTGAGAGTGG - Intergenic
1202483328 Y:25330862-25330884 CTGTGTCAACAACCTGAGAGTGG + Intergenic