ID: 1053339405

View in Genome Browser
Species Human (GRCh38)
Location 9:37310208-37310230
Sequence CTGAAAGGGACTAATGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053339405_1053339408 -8 Left 1053339405 9:37310208-37310230 CCTGCATCATTAGTCCCTTTCAG 0: 1
1: 0
2: 1
3: 1
4: 116
Right 1053339408 9:37310223-37310245 CCTTTCAGAAGACAAGAACCTGG No data
1053339405_1053339409 -1 Left 1053339405 9:37310208-37310230 CCTGCATCATTAGTCCCTTTCAG 0: 1
1: 0
2: 1
3: 1
4: 116
Right 1053339409 9:37310230-37310252 GAAGACAAGAACCTGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053339405 Original CRISPR CTGAAAGGGACTAATGATGC AGG (reversed) Intronic
900849864 1:5134063-5134085 CTGAATGTGACTTATGGTGCGGG - Intergenic
900954647 1:5879033-5879055 CTCAAAGGGATTCATGATCCAGG - Intronic
902540857 1:17153500-17153522 CTGTATGGGAAGAATGATGCTGG - Intergenic
908066957 1:60416352-60416374 TTGAAAAGGACTAAAGATGTGGG - Intergenic
913258187 1:116974176-116974198 ATGAAAGAGAATAATGAGGCTGG + Intronic
918045209 1:180937129-180937151 ATGAAATGAAATAATGATGCTGG - Intronic
918406866 1:184220160-184220182 TTGAAAGGGAATATTGACGCTGG + Intergenic
920635286 1:207696181-207696203 CTGAAAGCTGCTAATGCTGCAGG + Intronic
1064084258 10:12333419-12333441 CTGCAAGTGACAAATGACGCAGG - Intergenic
1064116913 10:12585983-12586005 CTGAAAGAAGCTGATGATGCTGG - Intronic
1065180331 10:23118532-23118554 CTCCCAGGGACTCATGATGCTGG - Intronic
1066180086 10:32953461-32953483 CTGACAGGGACAGATGTTGCTGG + Intronic
1068054097 10:51989394-51989416 CTGGAAGGGACGGATGAGGCAGG + Intronic
1070770353 10:79078909-79078931 CTGAAAGGGACTGTTTACGCGGG - Intronic
1072793125 10:98333514-98333536 CTGAAAGAGACTAATGCTAATGG - Intergenic
1074440708 10:113475213-113475235 CTGAAGGGAAGGAATGATGCTGG + Intergenic
1078117666 11:8470050-8470072 CTGTTAGTGACTAATGAAGCTGG - Intronic
1078906774 11:15694851-15694873 CTTAAAGGGGCTAAAGATACAGG - Intergenic
1084981726 11:72832529-72832551 CTGAACGGGACTGAAGAGGCTGG - Intronic
1086727678 11:90208888-90208910 CTAAAAGGGTTTAGTGATGCAGG - Intronic
1087397272 11:97616300-97616322 ATGAAAGGGTATAATGATGTTGG - Intergenic
1088371322 11:109091215-109091237 CTGAGACGGAGGAATGATGCAGG + Intergenic
1088855980 11:113754128-113754150 TTGTTAGGGACTAATGCTGCTGG + Intronic
1088966904 11:114732736-114732758 CAGAAAGGGAATATTAATGCAGG - Intergenic
1089526951 11:119103197-119103219 ATGAAAGGTAATAAAGATGCTGG - Intronic
1090775015 11:129956744-129956766 TTGAAAGGCACTAATTAGGCGGG + Intronic
1092952813 12:13524061-13524083 CTGAAAGGGAAAAATGACTCAGG + Intergenic
1094729253 12:33156045-33156067 CTGAAAGTCAATAACGATGCAGG + Intergenic
1095681318 12:44979908-44979930 CTGAGAGAGACTAATGATCATGG + Intergenic
1095800268 12:46265176-46265198 CTAAATGGGAATGATGATGCTGG - Intronic
1097679192 12:62632942-62632964 CTGAAAGGGACAAAAGAAACGGG + Intergenic
1100468306 12:94868467-94868489 CTGTTAGGGACTAATGTAGCTGG + Intergenic
1112253174 13:97802572-97802594 CTCAAAGGGACTAAAAAGGCTGG + Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1119782704 14:77288273-77288295 CTGAAAATGACTAAAAATGCTGG - Intronic
1120522443 14:85539904-85539926 CTGAATGGAAGAAATGATGCAGG - Intronic
1122186079 14:99997286-99997308 CTGGAAGGGAAGAATGATGTAGG + Intronic
1125708673 15:41765411-41765433 GTGAATGGGGCTAATAATGCAGG - Intronic
1125933996 15:43618935-43618957 GTGAGAGGGACTAATGATAGGGG + Intergenic
1125947093 15:43718397-43718419 GTGAGAGGGACTAATGATAGGGG + Intergenic
1126189838 15:45867862-45867884 CTGAAATGTTTTAATGATGCTGG - Intergenic
1126656027 15:50978830-50978852 CCTAAAAGGACTAAAGATGCTGG - Intronic
1129089134 15:73130314-73130336 CTGAAAGGGTCTTATGCGGCGGG - Intronic
1131878929 15:96841825-96841847 TTGAAAAGGGCTAATGAAGCTGG + Intergenic
1134194465 16:12148542-12148564 ATAAGAGGGACTAATCATGCAGG - Intronic
1136594093 16:31235281-31235303 TTGTTAGGGACTAATGCTGCTGG - Intergenic
1139751954 16:69114320-69114342 CTGCAAGGGAATAGAGATGCTGG - Intronic
1141265389 16:82492085-82492107 CTGAAATGGACTAATGTTTATGG + Intergenic
1141344016 16:83228791-83228813 GCGAAAGGGACAAATGATGGAGG + Intronic
1147436224 17:40417821-40417843 CTGAAAGCGACTAAACAGGCAGG + Exonic
1147631191 17:41933007-41933029 CTGAAAGGGACAAACGACTCTGG - Intronic
1155862617 18:30922388-30922410 TTAAAAGGGACTCATCATGCTGG - Intergenic
1157268077 18:46246352-46246374 CAGAAAAGGACTAATGGTCCTGG + Intronic
925932103 2:8716520-8716542 CTGAAAAGGTCTCATGAGGCTGG + Intergenic
927469588 2:23363012-23363034 CTGAAATGGGTGAATGATGCAGG + Intergenic
928010146 2:27599819-27599841 ATGAAAGGGTATAATGAGGCAGG - Intronic
928815954 2:35294590-35294612 CTGAAAGTCACTGATGATTCTGG + Intergenic
939338385 2:140861108-140861130 CTAAAAGAGACTAATGTGGCCGG + Intronic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
940967490 2:159855944-159855966 CAGAGAGAGACTAAAGATGCTGG - Intronic
946691936 2:222315827-222315849 GTGAAAGAAACTCATGATGCAGG - Intergenic
947136906 2:226984682-226984704 CTGAAAGGAACCACTGGTGCTGG + Intronic
1181399132 22:22640617-22640639 CAGAAAGGGATTAAGGTTGCAGG - Intergenic
1181650291 22:24255442-24255464 CAGAAAGGGAGTAAGGTTGCAGG + Intergenic
1182400955 22:30077451-30077473 CTGAAAGGTACAAAGGAAGCTGG + Intergenic
953308414 3:41852493-41852515 CTGAAAGGAACAAAAAATGCTGG + Intronic
953374962 3:42420842-42420864 CTGAAAGGCACTAAGGAGTCAGG + Intergenic
953492971 3:43365424-43365446 CTGAAATGGAGTAAAGATCCTGG + Intronic
953910760 3:46891835-46891857 CTGGGAGGGACTGGTGATGCTGG + Intronic
954025549 3:47780771-47780793 CTTAAAGGGTGTAATGAAGCAGG - Intronic
957155784 3:76542251-76542273 CTTATAGGGTCTAGTGATGCAGG + Intronic
958442133 3:94168345-94168367 AGAAAAGAGACTAATGATGCTGG - Intergenic
962476415 3:135759056-135759078 GTGAAGGGGACTGTTGATGCTGG - Intergenic
963188904 3:142447685-142447707 CCGAAAGGGGCTAAGGACGCAGG - Intronic
964649868 3:158998607-158998629 CTGAAGGGACCTAATGATTCAGG - Intronic
965255613 3:166405866-166405888 TTGTTAGGGACTAATGCTGCTGG - Intergenic
966012900 3:175103327-175103349 CTGAAAGGGAGTAATGGAGGAGG - Intronic
971596535 4:28536116-28536138 CTGCAAGGAACTAAAGATGTAGG + Intergenic
976779646 4:88744924-88744946 ATGAAAGGGAATAATAAGGCAGG + Intronic
976873013 4:89819258-89819280 CTGAAAGGGAGTAATGGCACCGG - Intronic
977622009 4:99148543-99148565 TTGAAAGGGACTAATAATGCTGG + Intronic
982877763 4:160669015-160669037 CTGAAATGGACTCTTGATGGAGG - Intergenic
983832695 4:172348561-172348583 ATGAAATGGGATAATGATGCTGG - Exonic
983948080 4:173608780-173608802 CTGCAAGGCAGTAATGAGGCTGG - Intergenic
990848340 5:60171344-60171366 CAGAAAGGGACCATTGATGAAGG + Intronic
991170383 5:63617527-63617549 CTGAAAAGGAAGAATCATGCTGG - Intergenic
992079650 5:73222992-73223014 CAGAAAGGGTCTGCTGATGCTGG + Intergenic
993060063 5:83028544-83028566 GTGAAAGGGTCTAATGATTATGG + Intergenic
995069008 5:107896183-107896205 CTTAAACGAAATAATGATGCGGG - Intronic
996864592 5:128105733-128105755 CTGCAAGGAAGTAATGATGATGG + Intronic
999626983 5:153531281-153531303 CAGTCAGGGACAAATGATGCAGG + Intronic
1002846275 6:948002-948024 AAGTAAGGGACTATTGATGCAGG + Intergenic
1004857235 6:19763902-19763924 CTGTTAGGGACTAATGCAGCTGG + Intergenic
1005138809 6:22602662-22602684 CAGAAAAGGACTCAGGATGCAGG - Intergenic
1006338837 6:33434772-33434794 CTGGAACAGACTGATGATGCAGG + Intronic
1007130086 6:39464177-39464199 CTGAAAGGGAGGCATGAGGCAGG + Intronic
1007728053 6:43928704-43928726 CTGGAAAGGACCAATGATTCAGG - Intergenic
1015033105 6:128619880-128619902 CTGAAAGGAGCAAATTATGCAGG + Intergenic
1017453855 6:154579976-154579998 GTGAAAGGTACTAATTATGTAGG + Intergenic
1021739580 7:23672503-23672525 TTGAAAGGGCCTAATACTGCAGG + Intergenic
1023175075 7:37428108-37428130 TTGAAAGGAATTAATAATGCAGG + Intronic
1024221896 7:47295437-47295459 CTGAAACTGAATAATGATGATGG - Intronic
1028323325 7:89490389-89490411 CTGAAATGGACTCAAGATTCAGG + Intergenic
1028383411 7:90224634-90224656 CAGCAAGGCACTAGTGATGCAGG - Intronic
1032304096 7:130716314-130716336 CTGTATGGGACTAAGGATGCTGG + Intergenic
1041477719 8:58284117-58284139 CTGAAAAGGAGTGATGATTCTGG + Intergenic
1043088625 8:75869746-75869768 CTGAAAAGGACAAATAAAGCAGG - Intergenic
1050092368 9:2027916-2027938 CTGATAGAGATCAATGATGCCGG - Intronic
1050496243 9:6245601-6245623 ATCTAAGGGACTAATGATGAAGG + Intronic
1051919646 9:22250397-22250419 CTGAAAAGGAAGCATGATGCTGG + Intergenic
1051956842 9:22705813-22705835 GAGAATGAGACTAATGATGCAGG + Intergenic
1052763711 9:32618806-32618828 CAGACAGGGACCAAGGATGCTGG + Intergenic
1053339405 9:37310208-37310230 CTGAAAGGGACTAATGATGCAGG - Intronic
1056068341 9:82960344-82960366 CTGAAAGTGATTTATGATGGAGG + Intergenic
1057439098 9:95069348-95069370 CTGAAAGGGACTTTTACTGCTGG - Intronic
1058717560 9:107736589-107736611 CTGCAAGGGACCACAGATGCTGG + Intergenic
1185554101 X:1006889-1006911 CTGAAAGTGACTAAGAATGTTGG - Intergenic
1189406212 X:40726765-40726787 GTGAAATGGGCTAATAATGCTGG - Exonic
1189717377 X:43880761-43880783 CAGAAAGGGACAAATCATGAAGG + Intronic