ID: 1053345405

View in Genome Browser
Species Human (GRCh38)
Location 9:37374531-37374553
Sequence TGCCATTGGTCTGGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053345405_1053345415 -3 Left 1053345405 9:37374531-37374553 CCTGCACCCCCAGACCAATGGCA No data
Right 1053345415 9:37374551-37374573 GCATCGGAATCTGTTGGATGGGG No data
1053345405_1053345413 -5 Left 1053345405 9:37374531-37374553 CCTGCACCCCCAGACCAATGGCA No data
Right 1053345413 9:37374549-37374571 TGGCATCGGAATCTGTTGGATGG No data
1053345405_1053345414 -4 Left 1053345405 9:37374531-37374553 CCTGCACCCCCAGACCAATGGCA No data
Right 1053345414 9:37374550-37374572 GGCATCGGAATCTGTTGGATGGG No data
1053345405_1053345412 -9 Left 1053345405 9:37374531-37374553 CCTGCACCCCCAGACCAATGGCA No data
Right 1053345412 9:37374545-37374567 CCAATGGCATCGGAATCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053345405 Original CRISPR TGCCATTGGTCTGGGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr