ID: 1053345984

View in Genome Browser
Species Human (GRCh38)
Location 9:37378610-37378632
Sequence ACTGGGGTCCCGATTCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053345984_1053345994 22 Left 1053345984 9:37378610-37378632 CCATGATGAATCGGGACCCCAGT No data
Right 1053345994 9:37378655-37378677 TGGCTGGTTCCGGATGCTTTTGG No data
1053345984_1053345989 6 Left 1053345984 9:37378610-37378632 CCATGATGAATCGGGACCCCAGT No data
Right 1053345989 9:37378639-37378661 TTCTCTCCCCACAATGTGGCTGG No data
1053345984_1053345995 23 Left 1053345984 9:37378610-37378632 CCATGATGAATCGGGACCCCAGT No data
Right 1053345995 9:37378656-37378678 GGCTGGTTCCGGATGCTTTTGGG No data
1053345984_1053345991 12 Left 1053345984 9:37378610-37378632 CCATGATGAATCGGGACCCCAGT No data
Right 1053345991 9:37378645-37378667 CCCCACAATGTGGCTGGTTCCGG No data
1053345984_1053345988 2 Left 1053345984 9:37378610-37378632 CCATGATGAATCGGGACCCCAGT No data
Right 1053345988 9:37378635-37378657 TTATTTCTCTCCCCACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053345984 Original CRISPR ACTGGGGTCCCGATTCATCA TGG (reversed) Intergenic
No off target data available for this crispr