ID: 1053346702

View in Genome Browser
Species Human (GRCh38)
Location 9:37383472-37383494
Sequence CTGGTTATCCAGAGCTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053346699_1053346702 -1 Left 1053346699 9:37383450-37383472 CCAGCTCAGATGTGATTCTGTCC No data
Right 1053346702 9:37383472-37383494 CTGGTTATCCAGAGCTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053346702 Original CRISPR CTGGTTATCCAGAGCTACCT AGG Intergenic
No off target data available for this crispr