ID: 1053351177

View in Genome Browser
Species Human (GRCh38)
Location 9:37414356-37414378
Sequence GCCCCTCAGTCTGCTCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053351177_1053351183 7 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351183 9:37414386-37414408 GGGGCAAGTGGCTTTCTGTGTGG No data
1053351177_1053351184 8 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351184 9:37414387-37414409 GGGCAAGTGGCTTTCTGTGTGGG No data
1053351177_1053351186 16 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351186 9:37414395-37414417 GGCTTTCTGTGTGGGGTGCAAGG No data
1053351177_1053351187 26 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG No data
1053351177_1053351182 -5 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351182 9:37414374-37414396 GGGGCTGAGAAAGGGGCAAGTGG No data
1053351177_1053351185 9 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351185 9:37414388-37414410 GGCAAGTGGCTTTCTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053351177 Original CRISPR GCCCCTCAGTCTGCTCTTCT GGG (reversed) Intergenic
No off target data available for this crispr