ID: 1053351187

View in Genome Browser
Species Human (GRCh38)
Location 9:37414405-37414427
Sequence GTGGGGTGCAAGGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053351177_1053351187 26 Left 1053351177 9:37414356-37414378 CCCAGAAGAGCAGACTGAGGGGC No data
Right 1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG No data
1053351178_1053351187 25 Left 1053351178 9:37414357-37414379 CCAGAAGAGCAGACTGAGGGGCT No data
Right 1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG No data
1053351175_1053351187 27 Left 1053351175 9:37414355-37414377 CCCCAGAAGAGCAGACTGAGGGG No data
Right 1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053351187 Original CRISPR GTGGGGTGCAAGGCTGCAGC AGG Intergenic
No off target data available for this crispr