ID: 1053351473

View in Genome Browser
Species Human (GRCh38)
Location 9:37416216-37416238
Sequence CTTCTCGCTTTAACTTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053351473_1053351476 3 Left 1053351473 9:37416216-37416238 CCTTTTCAAGTTAAAGCGAGAAG No data
Right 1053351476 9:37416242-37416264 TGCCCAAGTCCAGAGGCTTAGGG No data
1053351473_1053351475 2 Left 1053351473 9:37416216-37416238 CCTTTTCAAGTTAAAGCGAGAAG No data
Right 1053351475 9:37416241-37416263 CTGCCCAAGTCCAGAGGCTTAGG No data
1053351473_1053351474 -4 Left 1053351473 9:37416216-37416238 CCTTTTCAAGTTAAAGCGAGAAG No data
Right 1053351474 9:37416235-37416257 GAAGCTCTGCCCAAGTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053351473 Original CRISPR CTTCTCGCTTTAACTTGAAA AGG (reversed) Intergenic
No off target data available for this crispr