ID: 1053356485

View in Genome Browser
Species Human (GRCh38)
Location 9:37450221-37450243
Sequence GACACACTCGAGTTTAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053356485_1053356487 -3 Left 1053356485 9:37450221-37450243 CCATTCCTAAACTCGAGTGTGTC 0: 1
1: 0
2: 1
3: 8
4: 65
Right 1053356487 9:37450241-37450263 GTCTGTGTCCCAAATTTTCTTGG No data
1053356485_1053356490 18 Left 1053356485 9:37450221-37450243 CCATTCCTAAACTCGAGTGTGTC 0: 1
1: 0
2: 1
3: 8
4: 65
Right 1053356490 9:37450262-37450284 GGCCCGAGACAACGAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053356485 Original CRISPR GACACACTCGAGTTTAGGAA TGG (reversed) Intronic
903527160 1:23999904-23999926 GATTCACTCCTGTTTAGGAAGGG + Intergenic
904889694 1:33770610-33770632 GACACACTTGAGTGATGGAAGGG + Intronic
905459025 1:38109465-38109487 GACAGACTAGAGTCTAGAAATGG + Intergenic
911822678 1:102440583-102440605 GACACACATGAGTTTAGGAGCGG - Intergenic
912550349 1:110481444-110481466 GAGACACTGTTGTTTAGGAAGGG + Intergenic
917794327 1:178521835-178521857 CACACACTCAAGTTTTGGACTGG - Intronic
921122998 1:212152933-212152955 GACACACAGGAGCTGAGGAAAGG + Intergenic
921366450 1:214379087-214379109 GACACACTTAATTTTAGGAAAGG - Intronic
923068815 1:230544363-230544385 GACAGAATCCAGTTTAGGATGGG - Intergenic
924670587 1:246120415-246120437 GCGACCCTTGAGTTTAGGAAGGG - Intronic
1062979359 10:1708953-1708975 GACACACCTGAGGTAAGGAAAGG + Intronic
1065687999 10:28305038-28305060 GACACACTTAATTTTGGGAAAGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1088892719 11:114058071-114058093 AACACACTTGAGTGAAGGAAGGG - Intergenic
1089288789 11:117425090-117425112 GACAAAGTGGAGTTTTGGAAAGG + Intergenic
1090538264 11:127670729-127670751 CACACACAGGAGTTTAGGAGTGG - Intergenic
1091158237 11:133393992-133394014 GGCACACTAAAGTGTAGGAAAGG - Intronic
1091842536 12:3631230-3631252 AACACCCTCCAATTTAGGAAGGG - Intronic
1100167725 12:91937155-91937177 GTCACACTCCAGTGGAGGAATGG + Intergenic
1105844000 13:24279400-24279422 GACACAATCCAGTCTAGGAATGG + Intronic
1111599554 13:90454781-90454803 GACACACTTGAGTTTCTGAATGG - Intergenic
1122823991 14:104360836-104360858 GACACACTGGAGTCCAGGGAGGG + Intergenic
1129207569 15:74046069-74046091 GGGACACTAGAGCTTAGGAAGGG - Exonic
1131333167 15:91521464-91521486 GACACACATGAGTTTAGGAGTGG + Intergenic
1131540026 15:93268109-93268131 GACAGACTCTAGTTTAAGGAAGG + Intergenic
1136018827 16:27426812-27426834 GACACAGTGGAGTTGAGAAAAGG - Intronic
1143675554 17:8429976-8429998 GATTTACTTGAGTTTAGGAAGGG + Intronic
1145239102 17:21229242-21229264 GACCAAAACGAGTTTAGGAAGGG + Intergenic
1153324686 18:3806379-3806401 CACACACACGAGTCTAAGAATGG - Intronic
1159537312 18:69730412-69730434 AACAAATTCTAGTTTAGGAATGG - Intronic
1162456175 19:10786383-10786405 GACACACTCATGTCTGGGAACGG - Intronic
930522086 2:52480277-52480299 GATACACCTGAATTTAGGAAAGG + Intergenic
932465323 2:71919125-71919147 GACACACTAGAATCTAGAAATGG + Intergenic
933041912 2:77479627-77479649 GTCAGTCTCGAGGTTAGGAAAGG + Intronic
939019325 2:136940183-136940205 TAGACACTGGAGATTAGGAAGGG - Intronic
939647468 2:144718141-144718163 GACACACTGAAGTTGAAGAAGGG + Intergenic
942656286 2:178217479-178217501 GACACACACGAGTTTAGGAGTGG + Intronic
944335106 2:198523657-198523679 ATCACACTCAAGTTTTGGAAAGG - Intronic
944827245 2:203497014-203497036 GCAACACTTGAGTTTTGGAAGGG - Intronic
945258734 2:207824742-207824764 GACACACTCTAGCTGAGCAAAGG + Intergenic
947965912 2:234281474-234281496 AACACACTCCCGTTTAGAAAGGG + Intergenic
948614183 2:239187762-239187784 AGCACACTCGAGTTTAGGGTGGG - Intronic
1169074833 20:2754125-2754147 GACACACTGGACTTGAGGGAGGG + Intronic
1173284714 20:41659760-41659782 GACACACTCAAATTTGAGAAAGG - Intergenic
949247959 3:1947484-1947506 GATTCACTCAAGTTAAGGAAGGG - Intergenic
956554180 3:70499316-70499338 GACAGACTGGAGTTTAGGCCTGG - Intergenic
956607396 3:71086530-71086552 GAGACACTGGAGATTAGAAAAGG - Intronic
961933396 3:130557093-130557115 GTCACACGGCAGTTTAGGAATGG + Intergenic
967948355 3:194821909-194821931 CATTCACTCGAGTTTAGGAAAGG - Intergenic
971148967 4:24010843-24010865 GACACACTCCAGGTTGGGGAAGG + Intergenic
980508455 4:133754697-133754719 GACACACTGGAGGTTGGGGATGG + Intergenic
981534946 4:145789631-145789653 GACAGATTCGGGTTTGGGAAAGG - Intronic
982908045 4:161102340-161102362 CACATAGTCTAGTTTAGGAAGGG + Intergenic
988932131 5:36046997-36047019 GACATACACTTGTTTAGGAATGG - Intronic
994787484 5:104182571-104182593 GACACACACAAGTTTAAGAGTGG - Intergenic
999497899 5:152118167-152118189 GGCACACGTGAGTTTAGGAGTGG - Intergenic
1001433873 5:171684637-171684659 GAAACACTCGAGGGAAGGAAGGG + Intergenic
1002779482 6:355214-355236 GAAACACTCAAGTTTAAGGAAGG - Intergenic
1014486711 6:122008163-122008185 AATATCCTCGAGTTTAGGAATGG + Intergenic
1016058760 6:139606169-139606191 GACACAGTCTAATTTAGGCATGG + Intergenic
1021181890 7:17516909-17516931 CACACACTCAAAATTAGGAATGG - Intergenic
1023815110 7:43943568-43943590 GACACACCCTGGTTTAGGACTGG + Intronic
1030251978 7:107456560-107456582 GACAAATTTGAGTTAAGGAAGGG + Intronic
1031524779 7:122811022-122811044 GACATACTCTAGTTTACCAAAGG - Intronic
1032797197 7:135287420-135287442 GATACAATTGAGTTTAGCAAGGG + Intergenic
1045596966 8:103668079-103668101 GTCATATTAGAGTTTAGGAATGG + Intronic
1046263100 8:111796590-111796612 GACACACAGGAGTTTAAGAAGGG - Intergenic
1053356485 9:37450221-37450243 GACACACTCGAGTTTAGGAATGG - Intronic
1055913485 9:81376555-81376577 CACTCCCTCGAGTTGAGGAATGG - Intergenic
1057146584 9:92763355-92763377 GACACACTCAAGTGGGGGAAGGG + Intronic
1188250305 X:27885103-27885125 GACACACATGAGTTTAGGAGTGG - Intergenic
1191059338 X:56278203-56278225 GAGACACTCCAGCTGAGGAAAGG - Intronic
1192799936 X:74456264-74456286 CACACACTGGACTTTAAGAATGG - Intronic
1193803800 X:85970718-85970740 TACACAATCGAGTTATGGAAGGG - Intronic