ID: 1053359051

View in Genome Browser
Species Human (GRCh38)
Location 9:37470250-37470272
Sequence CTGTCATCCAAGCTGGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9604
Summary {0: 2, 1: 39, 2: 568, 3: 3405, 4: 5590}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053359051 Original CRISPR CTGTCATCCAAGCTGGAGTA CGG Intergenic
Too many off-targets to display for this crispr