ID: 1053361896

View in Genome Browser
Species Human (GRCh38)
Location 9:37493979-37494001
Sequence CAGAGGAGGGAGAAGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053361887_1053361896 14 Left 1053361887 9:37493942-37493964 CCGTGCTTATGGTGCTGGGGTTA 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG No data
1053361884_1053361896 18 Left 1053361884 9:37493938-37493960 CCTGCCGTGCTTATGGTGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053361896 Original CRISPR CAGAGGAGGGAGAAGGCCTC AGG Intronic
No off target data available for this crispr