ID: 1053365550

View in Genome Browser
Species Human (GRCh38)
Location 9:37520156-37520178
Sequence GTGGGTCGGGAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053365550_1053365572 28 Left 1053365550 9:37520156-37520178 CCTTCCTCCATTTCCCGACCCAC 0: 1
1: 0
2: 3
3: 39
4: 496
Right 1053365572 9:37520207-37520229 CCACAGTGATTTTGATAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053365550 Original CRISPR GTGGGTCGGGAAATGGAGGA AGG (reversed) Intronic
901192687 1:7421965-7421987 GTGGCTGGGGGAGTGGAGGAGGG + Intronic
901513300 1:9729171-9729193 CAGGGACGGGACATGGAGGATGG + Exonic
901620115 1:10578083-10578105 GTGTGTCGGGAAATTGAAGATGG + Intronic
901680364 1:10909555-10909577 ATGGGTCAGGAAATGAAGGAAGG - Intergenic
901719764 1:11187324-11187346 GGGGGTGGGGAGATGGGGGATGG + Intronic
902088703 1:13884747-13884769 ATGGTTAGGGAAATGGAGCAAGG - Intergenic
902186798 1:14731494-14731516 GTGGGAAGGGAAAGGGAGGATGG - Intronic
902201499 1:14836712-14836734 GTGGGGAGGGAAATGGAGAGGGG + Intronic
902374998 1:16026434-16026456 GGGGTTGGGGAGATGGAGGAGGG + Intronic
902379966 1:16048234-16048256 GGGGCTTGGGAGATGGAGGAGGG + Intronic
902544960 1:17184365-17184387 GGGGGTGGGGACAGGGAGGAGGG + Intergenic
902913017 1:19615053-19615075 GTGGGTCCAGAGAAGGAGGATGG - Intronic
904597240 1:31654564-31654586 GGGGCTCGGGGAATGCAGGAGGG + Intronic
905465605 1:38150980-38151002 CTGGGGCGGGAATTGGGGGAGGG - Intergenic
906096177 1:43225567-43225589 GAGGCTGGGGAAATAGAGGAGGG - Intronic
906466648 1:46087116-46087138 GTGTGTGGGGGAATGGTGGAGGG + Intronic
906797877 1:48711983-48712005 GTGGTTCAGGAAAAGGAGGTTGG - Intronic
906839017 1:49116360-49116382 CGGGGTGGGGATATGGAGGAGGG - Intronic
907310407 1:53535741-53535763 ATGGGTTGGGAAAGGCAGGAGGG - Intronic
907429723 1:54405237-54405259 GTGGGTCGGGAAAGGCAAGGTGG - Intronic
908687047 1:66732472-66732494 TTGGCCCTGGAAATGGAGGAAGG - Intronic
909094619 1:71271545-71271567 TAGGGTAGGGAAATGGGGGAGGG - Intergenic
909175042 1:72346736-72346758 GTGGGTAGGGGAAGGTAGGAAGG + Intergenic
909853778 1:80502664-80502686 GTGGGTGGGGGGATGGGGGAGGG + Intergenic
910321018 1:85944739-85944761 TGGGGTCGGGGAATGGGGGAGGG - Intronic
913189784 1:116403867-116403889 GTAGGTCTGGAAATAGAGTAAGG - Exonic
913201046 1:116495602-116495624 GGGGGTGGGGAGCTGGAGGAGGG - Intergenic
913992215 1:143625231-143625253 GAGGGTTGGGGAATGGATGATGG - Intergenic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
914421090 1:147529069-147529091 GTTGGTTGAGAAATGAAGGAGGG - Intergenic
915599809 1:156914991-156915013 GTGGGTTGGGAAAGGGAGCCAGG - Exonic
916035554 1:160919358-160919380 GTGGGTGGGGAAAAAGGGGAGGG - Intergenic
917763977 1:178197840-178197862 TTGGGTGGGGGAATGGGGGAAGG - Intronic
918631453 1:186723987-186724009 GAGGGTGGGGAAATAGGGGAGGG - Intergenic
919077104 1:192826885-192826907 GTGGGTAAGGAAGTGGAGGAGGG - Intergenic
919748897 1:201024505-201024527 GTGGGTGGGGAAGGGAAGGAGGG + Intergenic
920457034 1:206109346-206109368 GTGGGTTGGGGAAAGGAGGGAGG + Intergenic
920695903 1:208181193-208181215 CTGGGTCGGGAAGTGGTAGATGG - Intronic
920696383 1:208184203-208184225 GTGGGTTGAGACAGGGAGGAGGG + Intronic
921022807 1:211251875-211251897 GTGGATTGAGAAGTGGAGGAAGG - Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
923219401 1:231879631-231879653 ATGGGTGGGGAAATGGCTGATGG + Intronic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
1062854328 10:772232-772254 GGAGGTGGGGAAATGGAGGAGGG + Intergenic
1066502427 10:36007089-36007111 GAGGGTGGGGAAAGGGAGGAGGG - Intergenic
1067493168 10:46733697-46733719 GAGGGTGGAGAATTGGAGGAGGG - Intergenic
1067601492 10:47606709-47606731 GAGGGTGGAGAATTGGAGGAGGG + Intergenic
1067772510 10:49137670-49137692 GTGGGTGGGGAATTCCAGGAGGG - Intergenic
1067796857 10:49327145-49327167 GTGGGCCAGGAGAGGGAGGAAGG - Exonic
1068181661 10:53527480-53527502 CTGGGTCTGGAAAGGAAGGAAGG + Intergenic
1068241586 10:54308774-54308796 GGGGGTCGGGGAATAGGGGAGGG - Intronic
1068943457 10:62704491-62704513 GAGGGTGGGGAGCTGGAGGAGGG + Intergenic
1069185727 10:65420268-65420290 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1071653017 10:87414287-87414309 GAGGGTGGAGAACTGGAGGAGGG + Intergenic
1072365110 10:94701468-94701490 GTGGGGCGGGGAAAGGGGGAGGG + Intronic
1073431773 10:103491827-103491849 GTGGGCAGGGGAATGGGGGAGGG - Intergenic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1074119296 10:110481529-110481551 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
1074372685 10:112913158-112913180 GTGGGGCGGGAAATGAAGATGGG + Intergenic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1075396257 10:122129834-122129856 GTGGGTGGGAACATGGAGAATGG + Intronic
1075513966 10:123094724-123094746 TTGGGTCGGGCACTGGGGGATGG + Intergenic
1076650060 10:131981612-131981634 GTGGGTACGGAAGGGGAGGATGG + Intronic
1077318682 11:1930345-1930367 GTGAGTCCGGAAGTGGAGAAAGG + Intronic
1077430527 11:2513830-2513852 GTGGGCTGGGAGAGGGAGGAAGG + Intronic
1078510186 11:11979207-11979229 TTGTGTCAGGAAATGGAGGCTGG + Intronic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079008051 11:16806509-16806531 GTGGGTTGGGATGTGGTGGAGGG - Intronic
1079102347 11:17549535-17549557 GTAGGTAGGGAAATTGAGGTGGG + Intronic
1079367107 11:19819054-19819076 GTGGGTGGGTAGATGGATGAAGG - Intronic
1080246894 11:30189405-30189427 GAGGGTCAGGAAAGGGAGTAGGG + Intergenic
1081120255 11:39257049-39257071 GTGGGATGGGAACTGGAGCAAGG - Intergenic
1081183561 11:40014429-40014451 TTGGGTGGGGAGATGGGGGAGGG + Intergenic
1081453311 11:43194479-43194501 GTGGGTGGGGGCCTGGAGGAGGG + Intergenic
1081678416 11:44984826-44984848 GAGGGTAGGGCATTGGAGGAGGG + Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1083681519 11:64353959-64353981 GGGGGTCAGGACAGGGAGGAGGG - Intronic
1083928141 11:65821598-65821620 CTGGCTCAGGAACTGGAGGAAGG - Intergenic
1084263344 11:67992367-67992389 GTGGGTGGGGGAAGGGAGGGAGG - Intronic
1084305917 11:68283209-68283231 GTGGGTTCGAAAATGGTGGAGGG - Intergenic
1084810063 11:71606760-71606782 GTGGGTGGGGGAAGGGAGGGAGG + Intergenic
1084852725 11:71955896-71955918 GTGGGTAGGAAAAGGAAGGAGGG + Intronic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1085565113 11:77506611-77506633 GTGAGAAGGGGAATGGAGGAGGG + Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087215308 11:95487142-95487164 GTGTGTCGGGACAAGGAGGCAGG - Intergenic
1087757012 11:102064917-102064939 GTGGGATAGGGAATGGAGGATGG + Intronic
1087864449 11:103206887-103206909 ATGGGTCAGTAACTGGAGGAAGG + Intronic
1088094444 11:106081857-106081879 GTGGGTGGGGGAAGGGGGGAGGG + Intronic
1089619147 11:119712622-119712644 GTGGCTGGGGAAAGGGAGGGAGG - Intronic
1089700253 11:120240238-120240260 GGCGGCCGGGAACTGGAGGAAGG + Intronic
1090589178 11:128246918-128246940 GGGGGAGGGGAAATGGAGGGAGG - Intergenic
1090841070 11:130487807-130487829 GTGGGTCTGGAATGGGAAGAAGG - Intergenic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1092247602 12:6872375-6872397 GTGGTTCTGGACATGGAGGAGGG - Exonic
1092523824 12:9297565-9297587 GTGGGTAGGGAAATGTAAAAAGG - Intergenic
1092543474 12:9434334-9434356 GTGGGTAGGGAAATGTAAAAAGG + Intergenic
1092661491 12:10743428-10743450 GTGGGTGGGGGGATGGGGGAGGG - Intergenic
1093660480 12:21750870-21750892 GTTGGTGGGGAAATGGGGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1094052726 12:26238729-26238751 ATGGGACAGGAAATGAAGGAGGG - Intronic
1094509472 12:31087722-31087744 GTGGGTAGGGAAATGTAAAAAGG - Intronic
1094527036 12:31238190-31238212 GTGGGTCAGGGAATAGGGGAGGG + Intergenic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096594893 12:52688696-52688718 GTGGGTGGGGAGATGAGGGAAGG - Intergenic
1096625484 12:52892869-52892891 TTGGGTCGGGAAAGGCAGGGTGG + Intergenic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1098119958 12:67226234-67226256 GAGGGTGGGGAGATGGGGGAGGG - Intergenic
1098217807 12:68238460-68238482 GAGGGGCGGGAAATGGAAGGGGG + Intergenic
1098510349 12:71306036-71306058 GAGGGGAGGGAAATAGAGGACGG - Intronic
1098591686 12:72221839-72221861 GTGGGTCAGGAATTTGAGAAAGG + Intronic
1099853987 12:88141599-88141621 GTGGGTAGGGGTGTGGAGGAAGG - Intronic
1100272895 12:93043473-93043495 GAGGGTGGGGGAAGGGAGGAAGG - Intergenic
1100729345 12:97446922-97446944 GTGGATGGGGGCATGGAGGAAGG - Intergenic
1100868956 12:98890128-98890150 CTGGGTGGGTAAATGGAGGGAGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1102939613 12:116927815-116927837 GGGGGTCAGAGAATGGAGGATGG + Intronic
1103036882 12:117664142-117664164 GTGAGTGGGGAAAGGGAGGGAGG - Intronic
1103444827 12:120987997-120988019 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444877 12:120988186-120988208 GTGGGTGGGTAGATGGATGATGG - Intronic
1103857626 12:123984450-123984472 CTGGATGGGGAAATGGAGGGTGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104453007 12:128886601-128886623 ATGGCTCTGGACATGGAGGAAGG - Intronic
1104459620 12:128944938-128944960 GGGGGTCGGGGGCTGGAGGAGGG - Intronic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1106549643 13:30760247-30760269 CTGGGGTGGGAAGTGGAGGAGGG + Intronic
1107303362 13:38991305-38991327 GTGAGGCTGGAAAGGGAGGAAGG - Intergenic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1109624564 13:64958225-64958247 GTGGGTCTGGAAGTGCAGCAGGG + Intergenic
1110667739 13:78137706-78137728 GTGGGTGGGGAAGAGGGGGAGGG - Intergenic
1111222461 13:85221642-85221664 GTAGTTTGGGAAATGGAGGCAGG + Intergenic
1111420948 13:88010607-88010629 GGGGGTGGGGGACTGGAGGAGGG - Intergenic
1111629927 13:90837545-90837567 ATGGGTTTGAAAATGGAGGAGGG - Intergenic
1111750702 13:92328255-92328277 TTGGGTAGGCAAATGGAGTATGG + Intronic
1112438644 13:99409287-99409309 GTGGGTCAGGATATTGAAGAGGG + Intergenic
1112438987 13:99411660-99411682 GTGGGTCAGGATATTGAAGAGGG - Intergenic
1114347745 14:21814489-21814511 GTGGGTGGGGGAAGGGGGGAGGG + Intergenic
1115545680 14:34462871-34462893 ATGGGTGGGGGAAGGGAGGAAGG - Intergenic
1115744023 14:36417692-36417714 GTGGGGTGGGGACTGGAGGAGGG + Intergenic
1115808823 14:37082656-37082678 ATGGGTGGGGAAAAGGAAGAAGG - Intronic
1116370533 14:44125071-44125093 GTGGCTTTGAAAATGGAGGAAGG - Intergenic
1118864744 14:69694148-69694170 GTTATTGGGGAAATGGAGGAAGG + Intronic
1120040410 14:79746511-79746533 GTGGGGCTGGAAATGGAGCTAGG + Intronic
1121282123 14:92706507-92706529 GTGGGTCCGGAAGTGCAGCAGGG + Exonic
1121373230 14:93380336-93380358 GTGGGATGGGAAATGGGGGAAGG - Intronic
1121615606 14:95311675-95311697 TTGGGTCGGGGCATGCAGGATGG - Intronic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122538323 14:102481846-102481868 GTGGCTGGGGGAATGGGGGACGG - Intronic
1122540565 14:102495725-102495747 GTGGATCAGGACATGGAGGATGG - Intronic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1124059732 15:26278978-26279000 GAGGGGTGGGAAGTGGAGGAGGG - Intergenic
1124706724 15:31972605-31972627 GTGGGACTGGAAGTGGAGGCCGG + Intergenic
1125599393 15:40907090-40907112 GGGGGGCGGGAAGTGGAGGGAGG - Intergenic
1126296396 15:47141477-47141499 GTGGGTAGGAAAATAGAGGTTGG + Intergenic
1128157848 15:65402947-65402969 GTGGATGAGGGAATGGAGGAAGG + Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1128938232 15:71766325-71766347 TTGGGGTGGGAAGTGGAGGAAGG + Intronic
1129062078 15:72868198-72868220 GTGGCTTGGAAGATGGAGGAAGG - Intergenic
1130054173 15:80508095-80508117 TTCGGTTGGGAGATGGAGGAGGG - Intronic
1130298103 15:82661352-82661374 GTGGCTTGGGCAAGGGAGGAGGG - Intronic
1130556265 15:84924511-84924533 GAGTGTGGGGAAAGGGAGGAGGG - Intronic
1131733297 15:95304762-95304784 GTTGGAAGGGAAATGGAGGGTGG + Intergenic
1132808138 16:1785193-1785215 GTGGGGCTGGAAGTGCAGGAAGG - Intronic
1133019171 16:2959292-2959314 GTGGGATGGGCAAGGGAGGAGGG + Intergenic
1133255356 16:4513035-4513057 GTGGGTGGGGGCCTGGAGGAGGG + Exonic
1133785428 16:8969532-8969554 GGGGGTCAGGAATTGGAGGCTGG - Intergenic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135428757 16:22363739-22363761 ATGGGTTGGGACATGGAGAAAGG + Intronic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137949758 16:52772467-52772489 TTGGGTAGGGAAAAGCAGGAAGG + Intergenic
1138227700 16:55311975-55311997 GTGGGTAGGGAAAAGGGGGAAGG - Intergenic
1138332603 16:56227063-56227085 GCGGGTAGGGAAAAAGAGGAAGG + Intronic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1139716041 16:68813938-68813960 GTGGGCGGGGAAAAGGAGGCCGG + Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1139966954 16:70751037-70751059 GTTGGACAGGAAATGGAAGATGG + Intronic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1140579392 16:76211188-76211210 GTTGGACGGGAAATGGTGAAGGG + Intergenic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141478227 16:84288224-84288246 GTGGCTTTGGAGATGGAGGAAGG - Intergenic
1141698114 16:85629940-85629962 GTGGGCCAGGGATTGGAGGATGG + Intronic
1141823482 16:86463501-86463523 GTGGGGGGTGAAGTGGAGGAAGG + Intergenic
1142482962 17:229819-229841 GTGGGTCTGGAAAGGGAGAAAGG + Intronic
1142488261 17:260686-260708 GTGTGTCAGGTAATGGAGGAGGG - Intronic
1143018557 17:3904539-3904561 GTGTGGGGGGAAATGGGGGAAGG - Intronic
1143054937 17:4155774-4155796 GTGGGGAGGGAAAAGGAGGCAGG - Intronic
1143284697 17:5780468-5780490 GTAGGGCAGGAAATGGAGGTGGG + Intronic
1143284790 17:5781064-5781086 GGGGGTGGTGAAAGGGAGGAGGG + Intronic
1143519772 17:7438537-7438559 GGGCGTCGGGAAAAGGAAGAGGG + Intronic
1143522319 17:7451820-7451842 TTGGGTGGGGGCATGGAGGACGG - Intronic
1144027303 17:11289458-11289480 GTGGTAAGGGAGATGGAGGATGG - Intronic
1145286068 17:21506710-21506732 GTGGGAAGGGAAATGGGGGAGGG - Intergenic
1146103565 17:30009952-30009974 TGGGGTCGGGGGATGGAGGAGGG - Intronic
1146266663 17:31457552-31457574 GTGGGGCGGGACAAGGTGGAGGG + Intronic
1146461551 17:33049897-33049919 GTGGGACAGGGAAGGGAGGAAGG + Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146638826 17:34525384-34525406 GTGGGGCTGGAAAAGCAGGAAGG + Intergenic
1147402981 17:40192062-40192084 GTGGGTGGGGAAATGAAGTCAGG - Intronic
1147456537 17:40541720-40541742 GTGGCTCGGGACACGGTGGAGGG + Intergenic
1147758480 17:42782948-42782970 GTGGGTGGGGAGAGGGAGGCTGG + Intronic
1147791120 17:43014877-43014899 ATGGGTGGGGAGATGGAGCAGGG - Exonic
1148549128 17:48539756-48539778 TTGGGTAGGGAAATTGAAGATGG + Intergenic
1149027995 17:52052135-52052157 GAGGGTGGGGGAAGGGAGGAGGG + Intronic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1151379272 17:73713619-73713641 GTGCTTTGGGAAACGGAGGAGGG + Intergenic
1151676693 17:75602476-75602498 GTGGGGAGGGAAGTGGAGAAAGG - Intergenic
1151814004 17:76462145-76462167 CTGGGTCGGCTAAGGGAGGAAGG + Intronic
1151844617 17:76643643-76643665 GTGGGTCGGGTTCTAGAGGAAGG + Exonic
1152091656 17:78250791-78250813 GTGGGTCAGGAAGAGGATGAGGG + Intergenic
1152253230 17:79222659-79222681 GTGTGGGGGGACATGGAGGAGGG - Intronic
1153782372 18:8505641-8505663 GTGGGTTGGGAAGGGGAGAAGGG + Intergenic
1154921916 18:20819580-20819602 TGGGGTCGGGGGATGGAGGAGGG + Intergenic
1155887688 18:31228041-31228063 GTGGGGTGGGAATTGGAGGGAGG - Intergenic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156461098 18:37321736-37321758 CTGCGTCGGGAAAAGGAGGGAGG + Intronic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1156853592 18:41756148-41756170 GTGGGTGAGGAAATGGAGGCGGG - Intergenic
1156994548 18:43449568-43449590 GGGGGTGGGGATATGGGGGAGGG + Intergenic
1157074611 18:44451571-44451593 GTGGTTCGGGAAATAGTTGATGG - Intergenic
1157213035 18:45760138-45760160 GTGGGTGGGGAGTTGGAGGCAGG - Intergenic
1157618747 18:49003264-49003286 GTGGAAGGGAAAATGGAGGAGGG - Intergenic
1158210955 18:55049430-55049452 AAGTGTCAGGAAATGGAGGAAGG - Intergenic
1160284828 18:77532282-77532304 TGGGGTCGGGGAATGGGGGAGGG - Intergenic
1160366415 18:78329683-78329705 GTGGCTGGAGAACTGGAGGAAGG - Intergenic
1160659457 19:291438-291460 GAGGGGCGGGAAGGGGAGGAGGG + Intronic
1161210178 19:3061947-3061969 GTGGATCGGGAACTGGAGGGGGG + Intronic
1161478963 19:4501262-4501284 GAGGGTCGGGACTCGGAGGAGGG + Exonic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1163005553 19:14394873-14394895 TTGGATGGGGAAATGGATGAGGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164329332 19:24237225-24237247 GTGGGTGGGGGAAGGGGGGAGGG + Intergenic
1164627348 19:29738272-29738294 GGGGGTTGGAAAATGGGGGAGGG - Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164747071 19:30624227-30624249 GTGGGTCTGGAAAGACAGGAGGG - Intronic
1164857387 19:31535709-31535731 CTGGGAAGGGAAATGGAGAATGG + Intergenic
1165338760 19:35194953-35194975 GTGTGTCAGGAAGTGGGGGAAGG + Intergenic
1165468367 19:35988423-35988445 CAGGGTCGGGAAATGAATGATGG + Intergenic
1165475597 19:36028665-36028687 ATGGGTTGGGAGCTGGAGGAGGG - Intronic
1166030792 19:40125628-40125650 GGGGGTGAGGAAATGGAGGGAGG + Intergenic
1166812421 19:45522392-45522414 GTGGGGGGGGACCTGGAGGAGGG - Exonic
1167004170 19:46764798-46764820 GTGGGTGGGGCAATGGAGAAAGG + Intronic
1167041056 19:47022590-47022612 GGGGTTCGGGGCATGGAGGAGGG + Intronic
1167052145 19:47085751-47085773 CTGGGTCGGGACAGGGATGAAGG + Intronic
1167567067 19:50263289-50263311 CTGGGTGGGGAAATGGGTGAGGG - Intronic
1167698790 19:51030250-51030272 GAGGACCGGGGAATGGAGGAGGG - Intronic
1168229928 19:55024385-55024407 GTGGGCAGGGACATGGAAGATGG - Intronic
1168281263 19:55306612-55306634 GAGAGTGGGGAAATAGAGGATGG - Intronic
1168359058 19:55722996-55723018 GTGGGTGGGGAGCTGGGGGAGGG + Intronic
925267508 2:2576507-2576529 GGAGGTGGGGAAAAGGAGGAAGG + Intergenic
926710787 2:15878330-15878352 GTGGGTGGGGAGCTGGGGGAGGG + Intergenic
927199282 2:20568405-20568427 GCCGGGCGGGTAATGGAGGAAGG + Intronic
927402910 2:22734114-22734136 GGGGGTCGGGGACTGGAGGAAGG + Intergenic
928854202 2:35784594-35784616 GTGGGTCAGGAATTAGAGAAAGG - Intergenic
929616157 2:43310210-43310232 GGGGGGCGGGAAAGGGAGGGAGG - Intronic
929938772 2:46314726-46314748 ATTGGTCGGGAGCTGGAGGAAGG + Intronic
930752987 2:54949967-54949989 GTGGGCAGGGAACTGCAGGAAGG - Intronic
931318224 2:61152147-61152169 GTGGTTTAGGAAATGCAGGACGG + Intronic
932566744 2:72915784-72915806 GAGGGTGGGGAAAAGGAGGAGGG + Intergenic
935874385 2:107490118-107490140 GTGAGTGGGGAAGGGGAGGAAGG + Intergenic
936087438 2:109478900-109478922 GTGGGTTGGGAATTGGGGCAGGG + Intronic
936539316 2:113337121-113337143 GTGGGTCTGCTAATGGAGGTGGG + Intergenic
936663464 2:114567859-114567881 GGAGGTCGGGGACTGGAGGAAGG + Intronic
936745947 2:115576761-115576783 GTGGGCCTGGAGTTGGAGGATGG - Intronic
936939694 2:117871453-117871475 GTGGGTGGGGGAAGGGGGGAGGG - Intergenic
938184580 2:129218450-129218472 CTGGGGAGGGAAATGGAGCAGGG - Intergenic
939428392 2:142071096-142071118 GTAGGAGGGGAAATAGAGGATGG + Intronic
940039432 2:149344743-149344765 GTGGGTGCGGGAGTGGAGGAAGG + Intronic
940794144 2:158059118-158059140 GTGGGTCAGGCAATGGAACATGG - Intronic
941347701 2:164390405-164390427 GTGGGGCGAGAGATTGAGGAAGG - Intergenic
942412503 2:175725476-175725498 GTGGTTCAGGGAATGGAGAATGG + Intergenic
942455267 2:176133816-176133838 GTGGGTACGGAAATCAAGGAAGG + Intergenic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
942841264 2:180364206-180364228 GGGGGTGGGGAGATGGGGGAGGG + Intergenic
943011561 2:182455756-182455778 GTGGGTGGGGGAATGGGGGAGGG + Intronic
943221933 2:185120568-185120590 GTGGGGTGGGGAATGGGGGAGGG + Intergenic
944462947 2:199970783-199970805 CTGGGAAGGGAAATGGAGGTGGG - Intronic
944474776 2:200092484-200092506 GTGGGTGGGGATAGGGAGGATGG + Intergenic
945192735 2:207206930-207206952 GTGGGAATGGAAATGGAGGTTGG - Intergenic
946345591 2:219107879-219107901 GTTGGTGGGGCAAGGGAGGAGGG - Intronic
946366164 2:219250452-219250474 GTGGGTGAGGGCATGGAGGAGGG - Exonic
946369498 2:219272013-219272035 GTGGGTGAGGGCATGGAGGAGGG + Intronic
946530105 2:220561427-220561449 GTGGGTGGGGAGCTGGGGGAGGG + Intergenic
946967419 2:225052153-225052175 GGGGGTGGGGAGATGGGGGAGGG + Intergenic
947497172 2:230646301-230646323 GTAGATAGGGAACTGGAGGATGG - Intergenic
947745731 2:232506454-232506476 GTGGGGAGGGAAAGGGAAGAAGG + Intergenic
948031513 2:234821545-234821567 GTGGGTGGGGAAATAGCTGAGGG - Intergenic
1169410708 20:5367380-5367402 GTGGGTGGGGAAATAGGGAATGG + Intergenic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1171021664 20:21589723-21589745 GTGGGAGGGGAGATGGAGAAAGG - Intergenic
1171946386 20:31381961-31381983 GTGGGTGGGGACAGGGAAGAGGG + Intronic
1172320692 20:33993589-33993611 GTGGGGCCTGAAAGGGAGGAGGG - Intergenic
1172501539 20:35431681-35431703 CTGGGTGGGAAAATGCAGGAGGG + Intergenic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172634518 20:36401057-36401079 GCGGGTGGGGGACTGGAGGAGGG - Intronic
1173653698 20:44684341-44684363 ATGGGTAGAGAAATGAAGGAAGG + Intergenic
1175249098 20:57598174-57598196 GGGGGTGGGGAAAGGGGGGAGGG - Intergenic
1175385307 20:58591161-58591183 GTGGTTCAGGAAATGAAGAAAGG + Intergenic
1175407375 20:58743968-58743990 GTGGGTGGATACATGGAGGAGGG + Intergenic
1175831568 20:61967622-61967644 GGAGGTGGGGAAAGGGAGGAGGG - Intronic
1175907695 20:62389418-62389440 GTGGCTGTGGAAAAGGAGGAGGG + Exonic
1175930125 20:62489928-62489950 GTGGGTCTGGAATGGGTGGATGG - Intergenic
1177143629 21:17383994-17384016 GTGGGTGGGGGACTGGGGGAGGG + Intergenic
1178615576 21:34130111-34130133 GTGGGTGGGGGGATGGGGGAGGG - Intronic
1178978992 21:37245163-37245185 GTGGGAAGGGAAAGGAAGGAGGG + Intronic
1179891628 21:44338649-44338671 GCGGGCCGGGAAATGGGGGGGGG + Intronic
1180048244 21:45319597-45319619 GCGGGAAGGGAAGTGGAGGAAGG - Intergenic
1181284113 22:21739812-21739834 GCAGGTGGGGAAATGGAGGCTGG - Intergenic
1181497159 22:23293862-23293884 CTTGGCGGGGAAATGGAGGAGGG - Intronic
1181528371 22:23502534-23502556 GAGGGATGGGGAATGGAGGATGG - Intergenic
1181600768 22:23950546-23950568 GAGGGTAGGGAAATGGAGTGGGG + Intergenic
1181607744 22:23990773-23990795 GAGGGTAGGGAAATGGAGTGGGG - Intergenic
1182152856 22:28042581-28042603 GGGGGTGGGGGACTGGAGGAGGG + Intronic
1183224415 22:36539640-36539662 GTGGGTCAGGAATTGGGAGAGGG + Intergenic
1184046099 22:41973078-41973100 ATGGGTTGAGAAACGGAGGAAGG + Intergenic
1184434221 22:44460373-44460395 GTGGGTGGGTGAATGGATGAGGG - Intergenic
1184651321 22:45920622-45920644 CTGGTTCGGGAGATGGGGGATGG + Exonic
1185224305 22:49644174-49644196 GTGGGTCTGGAGATGGGGGTGGG + Intronic
950157030 3:10729340-10729362 GTGGGTCAGGAAATCAAAGAGGG - Intergenic
950579622 3:13853813-13853835 GTGGGTGAGGAAATTGAGGCTGG + Intronic
950620306 3:14200261-14200283 ATGTGTCAGGAAATGGAGGGAGG + Exonic
951798570 3:26569629-26569651 GTTGGTGGGGAAAGGCAGGAGGG + Intergenic
952281236 3:31925342-31925364 GTGGGAAGGGATGTGGAGGATGG - Intronic
952887223 3:38019151-38019173 GTGGGTGGGGAGATGGGGGCAGG - Intronic
953880137 3:46687183-46687205 GTGGGTGCAGGAATGGAGGAAGG - Intronic
954706700 3:52484851-52484873 GTGGGTGGGGAAGGGAAGGAGGG - Intronic
954916988 3:54156861-54156883 GTGGGTCAGGAATTGGGGAAGGG - Intronic
956299797 3:67759569-67759591 GTGGGTAGGGAACTAGGGGAGGG - Intergenic
957041644 3:75340626-75340648 GTGCGTCGGCAAGTCGAGGAGGG + Intergenic
957108055 3:75917179-75917201 GTGGGTGGGGGAAAAGAGGAGGG - Intronic
957517085 3:81269228-81269250 GTGGGCTAGGCAATGGAGGAGGG - Intergenic
960508637 3:118522744-118522766 GGGGGTTGGGAACTGGGGGAGGG + Intergenic
960551044 3:118976818-118976840 GGGGGTTGGCAAATGAAGGAAGG - Intronic
960810971 3:121627319-121627341 ATGGGACAGGAAATGCAGGATGG + Exonic
961080923 3:124027145-124027167 GTTGGTTTGGAGATGGAGGAAGG + Intergenic
961138772 3:124537602-124537624 GTGGTTTGGGAAAGGAAGGAAGG + Intronic
961664951 3:128489041-128489063 GTGGGTCGGGGGCAGGAGGAGGG + Intronic
961818162 3:129561763-129561785 GAGGGTGGGGAAATGGGGGCGGG + Intronic
962136571 3:132741285-132741307 GTGGGTGGGGGGCTGGAGGAGGG - Intergenic
962396399 3:135018472-135018494 GTGGGCTGAGAAAGGGAGGAAGG - Intronic
962820241 3:139041749-139041771 GTGGGTGGGGAGATAGGGGAGGG + Intronic
965076161 3:163979598-163979620 GTGGGTAGGGAACTAGGGGAGGG - Intergenic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
966961398 3:184943158-184943180 TTTGATGGGGAAATGGAGGAAGG - Intronic
968144706 3:196288256-196288278 GTGGGTCAGAAAAAGGAAGAGGG - Intronic
968594734 4:1476501-1476523 GTGGGTGGGTAGATGGATGATGG + Intergenic
968763016 4:2451983-2452005 GTGGGTCGGGGATAGGAGGAAGG + Intronic
969021857 4:4144277-4144299 GTGGGTGGGGGAAGGGAGGGAGG - Intergenic
969073291 4:4557122-4557144 GTGGACCAAGAAATGGAGGAAGG - Intergenic
969732010 4:8963138-8963160 GTGGGTGGGGGAAGGGAGGGAGG + Intergenic
970253376 4:14140825-14140847 GTGGGGTGGGGAATGGGGGAGGG + Intergenic
970349112 4:15183373-15183395 GTGGCCTGGGAAATGGAGGAAGG - Intergenic
970428327 4:15965370-15965392 GTGGGTGGGGGAAAGGAGGTTGG - Intronic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
971352323 4:25864613-25864635 ATAGTTCTGGAAATGGAGGAGGG - Intronic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
973745149 4:53956766-53956788 GGGGGTGGGGAAGGGGAGGAAGG + Intronic
974195121 4:58564358-58564380 GTGGGTCAAGATATGGAGGGTGG - Intergenic
976547948 4:86359561-86359583 GTGGGGCGGGAGAGGGAGTATGG - Intronic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
978230474 4:106391842-106391864 GTGGGAGGCCAAATGGAGGAGGG - Intergenic
979335958 4:119463140-119463162 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
981044635 4:140253462-140253484 GGGGGTGGGGATAAGGAGGAAGG + Intergenic
981558179 4:146017950-146017972 GTGGGGCAGGAATTGGGGGAAGG - Intergenic
981939792 4:150270572-150270594 AAGGGTCTGGAAATGGATGATGG + Intronic
982301447 4:153883032-153883054 GGTGGTAGAGAAATGGAGGAGGG - Intergenic
985558311 5:568913-568935 GCGGGTATGGAAATGGAGGTGGG - Intergenic
985966750 5:3343611-3343633 GTGGGTGGTGGGATGGAGGAGGG - Intergenic
985995707 5:3595947-3595969 GCGGGCCGGGAGATGGAGGCCGG - Intergenic
986285269 5:6354367-6354389 GAGGGTCTGGACATGGAAGAAGG + Intergenic
986610937 5:9566230-9566252 GAGGGTGGGGAATGGGAGGAGGG + Intergenic
986809429 5:11340097-11340119 AGAGGTCTGGAAATGGAGGAGGG - Intronic
987201387 5:15581352-15581374 AGGGGTGGGGAGATGGAGGATGG - Intronic
987250189 5:16092583-16092605 GTGGGTGGGGAAAAAGGGGAGGG + Intronic
989004065 5:36790141-36790163 GTGGCTGGGGGAAGGGAGGATGG - Intergenic
989027728 5:37086623-37086645 GTGGGGAGGGGAATGGAGGAAGG + Intergenic
989846627 5:46152249-46152271 GTGGGTGGGGGAATGGGGAAGGG + Intergenic
990140319 5:52695598-52695620 GTGGGTTGGCAAAAAGAGGAAGG - Intergenic
990550998 5:56878301-56878323 GGGGGTCGGGAGGTAGAGGAGGG + Intronic
991522334 5:67514984-67515006 GTGGGACTAGAAATGGATGAAGG + Intergenic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992034968 5:72764172-72764194 GTGAGGAGGGAAAAGGAGGATGG - Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
993665765 5:90693945-90693967 GTGGCTCTGGCAATGGAGGAAGG + Exonic
994237752 5:97384447-97384469 GTGGGAGGGGAGGTGGAGGATGG - Intergenic
995745409 5:115397214-115397236 GTAGGTCTGGAAAAGGAGAATGG + Intergenic
996967975 5:129328634-129328656 GTGGGTAGGGGACTGGGGGAGGG - Intergenic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
997457372 5:134027268-134027290 ATGGGGCGGGAGAGGGAGGAGGG - Intergenic
998164461 5:139835093-139835115 ATGGGTGGGGAAATGGGTGATGG - Intronic
998568632 5:143237830-143237852 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998568646 5:143237876-143237898 CTGGGTGTGGAATTGGAGGAGGG + Intergenic
998822616 5:146070304-146070326 ATGGGGCTGGAGATGGAGGAGGG + Intronic
999373202 5:151068748-151068770 GCAGGAAGGGAAATGGAGGATGG - Intronic
999570407 5:152913819-152913841 GTGGGTGGGGGGATGGGGGAGGG - Intergenic
999664033 5:153894254-153894276 GAGGGATGAGAAATGGAGGAAGG - Intergenic
999671939 5:153965877-153965899 GTGGGTGGGTAAATGGAGACAGG - Intergenic
1000009290 5:157216624-157216646 GTGGGGAGGGAAAGGAAGGAAGG + Intronic
1000073990 5:157767733-157767755 GAGGGTGGCCAAATGGAGGAAGG + Intergenic
1000244907 5:159441381-159441403 GGGGGTTGGGAAATGAAGGGTGG + Intergenic
1000508661 5:162154052-162154074 TTGGGTTTGGAAATGGAGGGAGG + Exonic
1001080421 5:168663309-168663331 GGGGATGGGGAAATGGAGGTTGG + Intronic
1001082257 5:168676076-168676098 GTGGGTGGGTAGATGAAGGATGG - Intronic
1001180131 5:169512679-169512701 GTGGGACAGGAAACTGAGGAGGG - Intergenic
1001752755 5:174144205-174144227 GTGGGTCAGGAATTGGAGAATGG + Intronic
1001809775 5:174618789-174618811 GGGGGTGGTGAAATGGGGGAAGG + Intergenic
1003025281 6:2549672-2549694 GTGGGTAGGAAAAGGGATGAAGG + Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003395693 6:5750272-5750294 GTGGGGCAGGATATAGAGGAAGG + Intronic
1006076003 6:31532926-31532948 GGGGGTGGGGAACGGGAGGAGGG + Intronic
1006626739 6:35403015-35403037 GTGGGGCGAGAAGGGGAGGAAGG + Intronic
1006641612 6:35492327-35492349 GTGGGGCGGGTAGGGGAGGAGGG - Intronic
1006718597 6:36135862-36135884 GTGGGTGGGGACTTGGAGGCTGG + Intronic
1007626317 6:43248189-43248211 GTGGGGAGCGAAATGGAGCAGGG + Intronic
1009314689 6:62203547-62203569 GTGGGTGGGGGAAAGGAGGGAGG + Intronic
1010080491 6:71856011-71856033 GTGGGATGGAAACTGGAGGAAGG - Intergenic
1010314833 6:74436081-74436103 TCGGGTGGGGAAATGGGGGAGGG - Intergenic
1011677080 6:89745097-89745119 GTGGGTCGGGGGCTGGGGGAGGG - Intronic
1012027307 6:94012599-94012621 ATGGTTTGGGAAGTGGAGGAAGG + Intergenic
1012029834 6:94044886-94044908 GAGGGTAGGGGAATGGAGGAGGG + Intergenic
1012924115 6:105250357-105250379 TGGGGTCGGGGGATGGAGGAGGG + Intergenic
1012974356 6:105764023-105764045 GTGGGTCAGGAATTTGAGAAGGG + Intergenic
1013091600 6:106905348-106905370 CTGGGTCGGGAAACAGAGCAAGG - Intergenic
1014227952 6:118869260-118869282 GGGGGTGGGGAACTGGGGGAAGG + Intronic
1014767195 6:125420593-125420615 GTGGGTGGGGAAATTTAGGTGGG + Intergenic
1015325281 6:131917546-131917568 GTGGCTTGTGAAAGGGAGGAGGG + Intergenic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1016337977 6:143029383-143029405 GTGGGTGGGGGACTGGGGGAGGG - Intergenic
1016371735 6:143381874-143381896 GTGGTTAGGGAAAGGAAGGAAGG + Intergenic
1016985103 6:149889171-149889193 GTGGGATGGGAAAGGGAGGATGG + Intronic
1017905704 6:158756364-158756386 GTGTTGCGGGGAATGGAGGAGGG + Intronic
1019223993 6:170495829-170495851 AGGGGTCGTGAAAAGGAGGATGG + Intergenic
1019224056 6:170496109-170496131 AGGGGTCGTGAAAAGGAGGATGG + Intergenic
1019510478 7:1415189-1415211 GTGGGTGGGTGAATGGAGGGAGG + Intergenic
1019510508 7:1415285-1415307 GTGGGTGGGTGAATGGAGGGAGG + Intergenic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019815312 7:3195658-3195680 GTGGGTGGGTAAACAGAGGAGGG + Intergenic
1020309278 7:6856307-6856329 GTGGGTGGGGGAAGGGAGGGAGG - Intergenic
1020735462 7:11943772-11943794 AGGGGTTGGGAAAGGGAGGAAGG - Intergenic
1021105559 7:16635345-16635367 GTGGGTGGGGAAGGGCAGGAAGG + Intronic
1021125349 7:16845667-16845689 GGCAGTTGGGAAATGGAGGATGG + Intergenic
1023834666 7:44061112-44061134 GAGGGTCGGGGGATGCAGGAAGG - Exonic
1024044855 7:45579484-45579506 GTGGGAGGGGAAGTGGAGGAGGG - Intronic
1024666520 7:51552278-51552300 GGGGGTGGGGAGCTGGAGGAGGG - Intergenic
1025836529 7:65099259-65099281 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1025906298 7:65788693-65788715 TTGGGTGGCCAAATGGAGGAAGG + Intergenic
1026172219 7:67963906-67963928 GTGGGTAGGGGAGTGGGGGATGG + Intergenic
1026525499 7:71149976-71149998 GTGTGTCGGGGGCTGGAGGAGGG + Intronic
1026769277 7:73184059-73184081 TTGGGTGGGCAAGTGGAGGAAGG + Intergenic
1027010147 7:74737442-74737464 TTGGGTGGGCAAGTGGAGGAAGG + Intronic
1027077895 7:75208593-75208615 TTGGGTGGGCAAGTGGAGGAAGG - Intergenic
1027191104 7:75995872-75995894 GTGGATAGGGAGATGGGGGAGGG + Intergenic
1027601140 7:80242786-80242808 GTGAGGCAGGAAAGGGAGGAAGG + Intergenic
1028639496 7:93027229-93027251 GTGGGTAGGTAAAGGGAGGGGGG + Intergenic
1029282403 7:99444492-99444514 GTGGGTGGGGAAAGGAAGGCTGG - Intronic
1029706327 7:102278195-102278217 GTGGGTGGGGAGATGTCGGAAGG - Intronic
1030278554 7:107745095-107745117 ATAGGTCGGGAGATGGAAGATGG + Intronic
1030282993 7:107796489-107796511 GTGGGTGGAGAGATGGAAGAGGG - Intronic
1030711441 7:112754632-112754654 GTGGGTGGGGAGATAGGGGAGGG - Intergenic
1032518621 7:132525707-132525729 GTGGGTCTGGAGATGCAGGTTGG - Intronic
1032708701 7:134444071-134444093 GTGGGAGGGGAAAAGGAAGACGG + Intronic
1032781077 7:135165733-135165755 CTGGGTTGGGAAGTGGAGGGTGG - Exonic
1033208344 7:139441471-139441493 GTGGGTGGGGGACTGGGGGAGGG + Intergenic
1033279431 7:139995362-139995384 GAGGGATGGGAAATGCAGGAGGG + Intronic
1033888088 7:145972546-145972568 TGGGGTCGGGGGATGGAGGAGGG + Intergenic
1034427922 7:151024215-151024237 GTGGGAGGGGAAAATGAGGAGGG + Exonic
1035106583 7:156446320-156446342 TTGGGGTGGGAAATGGAGGAAGG + Intergenic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1038521675 8:28238508-28238530 GTGAGCCAGGAAATGGAGAAGGG - Intergenic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1041350057 8:56939411-56939433 GTGGGTGGGGACTTCGAGGAGGG + Intergenic
1041981602 8:63867858-63867880 GTGGGTAGGGATTGGGAGGAAGG - Intergenic
1043050234 8:75377031-75377053 GTGGGACAGGAGCTGGAGGAGGG - Intergenic
1043144656 8:76637827-76637849 GGGGGTGGGGAGATGGGGGAGGG + Intergenic
1043827462 8:84946721-84946743 GTGGGATGGGGAAGGGAGGAGGG - Intergenic
1045968065 8:108049098-108049120 GAGGGTGGGGAACTGGGGGACGG + Intronic
1048986458 8:139737566-139737588 GTGGACCAGGAAATGGAGGGTGG - Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049421362 8:142517995-142518017 GCGGGTGGGGAGGTGGAGGAGGG + Intronic
1049538078 8:143191774-143191796 GTGGGTCAGGGAGTGCAGGAAGG + Intergenic
1049662350 8:143825105-143825127 GGGGGTCGGGAGATGATGGAAGG + Intronic
1049740615 8:144239247-144239269 GGGTGTCAGGAACTGGAGGATGG - Intronic
1051759741 9:20449011-20449033 GTAGGTAGAGAAATGGAGGTAGG - Intronic
1052987946 9:34501768-34501790 GTGGGTGGGGGCATGGGGGATGG + Intronic
1053241007 9:36495589-36495611 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1053293590 9:36898090-36898112 CTGGGTTTGGAAATGGAGGATGG + Intronic
1053365550 9:37520156-37520178 GTGGGTCGGGAAATGGAGGAAGG - Intronic
1054792126 9:69266094-69266116 GTGGGACGGGAAGGGGAGGCGGG + Intergenic
1056226433 9:84500157-84500179 GTGGGTCAGGAATTAGGGGAGGG + Intergenic
1056272350 9:84958680-84958702 CTGGGTAGGGAAGTGAAGGATGG + Intronic
1056764300 9:89435500-89435522 GTGAGTTGGGGAAAGGAGGAGGG - Intronic
1057513758 9:95703441-95703463 GTGGGTCGGGGGAGGGGGGAGGG + Intergenic
1057777974 9:98026255-98026277 CTAGGACAGGAAATGGAGGAGGG + Intergenic
1057926811 9:99159738-99159760 GTGCGTCGGGACATGCAGCATGG - Intergenic
1057993542 9:99798333-99798355 GAAGGTGGGGAAATGGAGGTAGG - Intergenic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058203339 9:102070907-102070929 GTGACTGGGGAAATGGAGGATGG - Intergenic
1059435894 9:114276022-114276044 GTGTGTCTGGATATGGGGGATGG - Intronic
1060905734 9:127303430-127303452 GTAGGTTGGGTCATGGAGGATGG + Intronic
1061170156 9:128947813-128947835 GCGGGGCGGGAATTGGAGGCGGG + Intronic
1061883819 9:133581345-133581367 GAGGCTTGGGAAATTGAGGAAGG - Intronic
1061885630 9:133589886-133589908 GTGGGTCAGGAAATGGGGGGTGG + Intergenic
1062182336 9:135197123-135197145 GTGCCTGGGGAAATGCAGGAAGG - Intergenic
1062425910 9:136506068-136506090 GGGGGTCGGGAGATGGAGGAAGG + Intronic
1062488394 9:136792226-136792248 GTGGAGCAGGAAATGGAAGAGGG - Intronic
1185518537 X:719114-719136 GGGGGTGGGGAACTGGGGGAGGG - Intergenic
1186574058 X:10746572-10746594 GTGGCTAGGAAAATGGTGGAAGG - Intronic
1187614161 X:20974947-20974969 GTGGGTGGGGGAAGAGAGGAGGG + Intergenic
1187630884 X:21170451-21170473 GAGGGCTGGGAAATGGAGGAAGG - Intergenic
1187790102 X:22941428-22941450 GTGGGTCAGGAAATTGAGGAAGG - Intergenic
1188029676 X:25250507-25250529 GAGGGTGGGGAGTTGGAGGAGGG - Intergenic
1188117962 X:26268261-26268283 GTGGCTTTGAAAATGGAGGAAGG - Intergenic
1189377718 X:40478722-40478744 TTGGGTGGGGAAAGGGAGGCAGG - Intergenic
1189641206 X:43072853-43072875 GGGGGTCGGGGAATAGAGGAGGG + Intergenic
1190586025 X:51943216-51943238 GAGGGTCGGGGATGGGAGGAGGG + Intergenic
1190693313 X:52930597-52930619 GTGGGTGGGGGGATAGAGGAGGG + Intronic
1191654894 X:63585928-63585950 GTTGGTAGGGGAATGGAGGTGGG + Intergenic
1191791570 X:64976933-64976955 GGGGGTGGGGAAGAGGAGGATGG + Intronic
1192630354 X:72773035-72773057 GTGGGGCGGTAAAGGGAGGCAGG + Intergenic
1192651356 X:72947769-72947791 GTGGGGCGGTAAAGGGAGGCAGG - Intergenic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1193516237 X:82468414-82468436 GTGGGTGGGGTAATAGGGGAGGG - Intergenic
1194344381 X:92745193-92745215 GGGGGTGGGGAATGGGAGGAGGG - Intergenic
1194750900 X:97683016-97683038 GTGGGTCAGGAAGTTGGGGAGGG + Intergenic
1194957053 X:100193183-100193205 GTGTGTCGGCAACTGGAGGCTGG - Intergenic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1196635661 X:117999543-117999565 GGGGGTGGGGAGATGGGGGAGGG + Intronic
1197841397 X:130751200-130751222 GTGGCTAGGGGAAGGGAGGAAGG - Intronic
1197962967 X:132025051-132025073 GTGCGTGGGGAAAAGAAGGAGGG - Intergenic
1198624379 X:138553190-138553212 GTGGGTTGGCAATTGGAGGAGGG + Intergenic
1199503855 X:148539618-148539640 TTGGGTGGGGAAAGGGAAGAGGG - Intronic
1200652726 Y:5861834-5861856 GGGGGTGGGGAATGGGAGGAGGG - Intergenic