ID: 1053366778

View in Genome Browser
Species Human (GRCh38)
Location 9:37528434-37528456
Sequence CAGCATGAGCAAAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 1, 2: 17, 3: 121, 4: 745}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053366778_1053366781 -10 Left 1053366778 9:37528434-37528456 CCCTGCTGCCTTTGCTCATGCTG 0: 1
1: 1
2: 17
3: 121
4: 745
Right 1053366781 9:37528447-37528469 GCTCATGCTGTTCCATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053366778 Original CRISPR CAGCATGAGCAAAGGCAGCA GGG (reversed) Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901287309 1:8091210-8091232 GAGCACGTGCAAAGGCACCATGG + Intergenic
901882476 1:12202323-12202345 CAGCATGGGCAAAGGCGGGAGGG - Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902479633 1:16704763-16704785 CAGCATGGGCAATGTAAGCAGGG - Intergenic
902757146 1:18556374-18556396 CAGGATGTGCAAAGGTAGCCCGG + Intergenic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
902977309 1:20098285-20098307 CAGCAAGAGCAAGGGCAGAAAGG - Intergenic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903296035 1:22343629-22343651 CAGCATGTGCAAAGGCCCCGAGG + Intergenic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903453571 1:23471193-23471215 CAGCATGAGCAAAGGTCTGATGG - Intronic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
903585932 1:24415403-24415425 CAGCAGGAGCAAAGCCCGGAAGG + Intronic
903614533 1:24642514-24642536 CAGCCAGAGCAGAGGCACCAGGG + Intronic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
904395597 1:30219390-30219412 CAGCAGGACCAAGGTCAGCAAGG + Intergenic
904460634 1:30677661-30677683 CAGCATGTGCAAAGGCTGGGAGG + Intergenic
904490897 1:30858433-30858455 CAGCATGGGCAAAGGTAGAGAGG - Intergenic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904882672 1:33712475-33712497 CAGCCTGAGCCTCGGCAGCAGGG + Intronic
904960995 1:34332715-34332737 CAACAGGAGGGAAGGCAGCACGG - Intergenic
905709173 1:40086296-40086318 CAGCATCTGCAAAGGCAAAAGGG + Intronic
905847756 1:41246950-41246972 CAGCATGAACAAAGACAAAAAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
906021238 1:42631519-42631541 CAGCAGATGCAAAGCCAGCAAGG + Intronic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907119885 1:51999126-51999148 CAGCATGAACAAAGGCCCAAAGG + Intergenic
907234345 1:53031438-53031460 CTGCATTAGCAAAGGCAGCCTGG + Intronic
907426762 1:54384640-54384662 CAGCCTGTGCAAAGGCCCCAAGG + Intronic
907440201 1:54474247-54474269 CAGCATCAGCAAAGGCACAAAGG - Intergenic
907516412 1:54996088-54996110 CAGCATGTGCAAAGGCACTGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907584561 1:55605603-55605625 CAGCATGAACAAAGGCTTCAAGG - Intergenic
907711808 1:56890167-56890189 CAGCATGTGCAAAGGAGGCCAGG - Intronic
907811516 1:57875311-57875333 GAGCATGTTCAAAGGCAGCAAGG - Intronic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908184562 1:61640317-61640339 CAGCACAAGCAAAGGCACGAGGG + Intergenic
908333625 1:63097401-63097423 CAGTATGAGCAAAGACATCGAGG + Intergenic
908338708 1:63154280-63154302 CATCATGAGCAATGGCACAAAGG + Intergenic
908394798 1:63715743-63715765 GAGAATGAACAAAGGCTGCAAGG + Intergenic
908656856 1:66397324-66397346 AAGCATGAGCAAAGGCTTTATGG + Intergenic
909658202 1:78054094-78054116 CAGCATGAGAAAAAGCACAATGG - Intronic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
911145319 1:94546799-94546821 CATCACCATCAAAGGCAGCAAGG - Intergenic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
912185991 1:107276411-107276433 TGGCATAAGCAAAGGCAGGAGGG - Intronic
912452287 1:109774434-109774456 CTGGATGAGCAAATGCAGCCTGG - Intronic
912976492 1:114335692-114335714 TAGCATGAGCAAAGGCATGAAGG + Intergenic
913343445 1:117783252-117783274 TACCATGTGCAAAGGCAGCGTGG + Intergenic
914405424 1:147366154-147366176 AAGAAAGAGCAAAGGCAACAAGG + Intergenic
914465451 1:147924023-147924045 CTGCCTGAGCACAGACAGCAGGG + Intergenic
915338182 1:155160256-155160278 CAGCAAGTGCAAAGGCCGCGAGG + Intergenic
915730597 1:158051226-158051248 CAGCATAAGCACAGGCACAAAGG - Intronic
916444581 1:164860526-164860548 CATCATGAGCAAAGGTAAAAAGG - Intronic
916578999 1:166091096-166091118 CAGCATGAACAATGGCCTCAAGG + Intronic
916678687 1:167085430-167085452 CAGCATCACAATAGGCAGCATGG + Intronic
916769058 1:167890601-167890623 CAGCAGGTGCAAAGCCAGCCAGG + Intronic
916854775 1:168738220-168738242 CAGCAAAAGCTAAGGCTGCATGG - Intergenic
917796249 1:178534736-178534758 CAGCGTTAGCAAAGGCACAATGG - Intronic
918097678 1:181348277-181348299 CAGCATGCCCAAGGTCAGCATGG + Intergenic
918533737 1:185551536-185551558 TAGCATAAGCAAAGGCACGAAGG - Intergenic
919406924 1:197196813-197196835 CAGCATGTGCAAAGGCATTGAGG - Intronic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919691669 1:200533300-200533322 CAGCCTGGGCAAAATCAGCAAGG + Intergenic
919777684 1:201205014-201205036 CAGTGTGACCTAAGGCAGCAAGG - Intronic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921412615 1:214851768-214851790 CAGCGTGATGAAAGGCAGGAAGG - Intergenic
921588960 1:216981118-216981140 CAGCAAGGGCAGAGGTAGCATGG - Intronic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
921902393 1:220463978-220464000 GAGCTTGGGCAAAGGCACCATGG + Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922595017 1:226806940-226806962 CAACATGAGGAAAGGCCTCAGGG + Intergenic
922973306 1:229761244-229761266 CAGACTGAGCAGAGGAAGCAGGG - Intergenic
923087764 1:230714179-230714201 CAGCCTGTGCACAGGCAGCCTGG - Exonic
924422084 1:243918848-243918870 CAGCATGTGCAAATACAGCAGGG + Intergenic
1062783441 10:238860-238882 CTGCATGAGTAAAGGCAGTGGGG - Intronic
1063625564 10:7686402-7686424 CAGTATGAGCAAAGGCTCCCAGG - Intergenic
1063941312 10:11132800-11132822 CATCATGAGCAAAGGCCTAAGGG - Intronic
1066254740 10:33667466-33667488 CAGTAAGAGCAAAGGAATCAAGG + Intergenic
1066510253 10:36087591-36087613 CAGTATCAGCTAAGCCAGCAAGG + Intergenic
1067146264 10:43695869-43695891 GAGCAAAAGCAAGGGCAGCACGG - Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067582973 10:47457158-47457180 GAGCAGGAGTAAAGGAAGCAAGG + Intergenic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1067822341 10:49540966-49540988 CAGCCTGAGCTAAGGCAGCTGGG - Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068201315 10:53787566-53787588 CAGCATGAACAAAAGAAGCCTGG - Intergenic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069294803 10:66830534-66830556 CAGCATAAACCAATGCAGCATGG + Intronic
1069678243 10:70265046-70265068 CAGCATTGGCAAAGGAAGCTGGG + Intronic
1069790055 10:71013717-71013739 CAGCATGTGCAAAGGCCCTATGG + Intergenic
1069890824 10:71651584-71651606 CAGCATGTGCAAAGGCCCCGTGG + Intronic
1070016876 10:72542549-72542571 CAGCAGGAGCAAACGCCGTACGG + Intronic
1070055202 10:72927757-72927779 CAGCATGCGCAAAGTCAGAAGGG - Intronic
1070310066 10:75266496-75266518 CAGCATGAGCAAAGACCTGAAGG - Intergenic
1070470681 10:76775959-76775981 GATCATGGGCAAAGGCTGCAAGG + Intergenic
1070572902 10:77654638-77654660 CTGCATGAGCAAAGACATCAAGG + Intergenic
1071497140 10:86176432-86176454 CAGCATGTGCAAAGGCACTGAGG + Intronic
1071524449 10:86350088-86350110 CAGCATGTGCAAAGGCCCCAGGG + Intronic
1071709894 10:88039715-88039737 CAACTTGAGCAAATGCAGGAGGG + Intergenic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072305012 10:94098900-94098922 CAGGCTGTGCAAGGGCAGCAAGG + Intronic
1072768540 10:98116527-98116549 CAACACGTGCAAAGGAAGCAAGG + Intergenic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073353280 10:102834808-102834830 CAACCTGAGCAAAGACAGCCTGG - Exonic
1073422097 10:103432911-103432933 CAGCATGAATAAAGACAGGAAGG - Intronic
1073515960 10:104075774-104075796 CAGCATAAGCAAAGACAGCCAGG - Intronic
1073817324 10:107222401-107222423 CAGCATGATTAAAGGCAGAGAGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074411658 10:113234034-113234056 CACCAGGAGCAGAGGCAGCCAGG - Intergenic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1074850054 10:117432443-117432465 CTACATGAGGAAAGGCAGGAGGG - Intergenic
1074893173 10:117752159-117752181 CAGCATGTGCAAAGGCCCCCTGG + Intergenic
1075083629 10:119399911-119399933 CAGCCTGAACAAAGGCCACAAGG - Intronic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075200761 10:120402016-120402038 CAGCATGTGCAAAGGCACTGGGG - Intergenic
1075307102 10:121377855-121377877 CAGCTTGAGAAGAGGCACCAAGG - Intergenic
1076070627 10:127485431-127485453 CAGCGTGAGCAAGAGCAGCAGGG - Intergenic
1076463514 10:130662428-130662450 CAGCATGAGAGGAGGCTGCATGG + Intergenic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077091573 11:780705-780727 TAGCAAGTGCAAAGGCTGCAAGG - Intronic
1077256185 11:1584504-1584526 CAGCCTGAGGAACAGCAGCAGGG + Exonic
1077360112 11:2137121-2137143 CAGCCTGAGGCAGGGCAGCAGGG - Intronic
1077916728 11:6616460-6616482 CAGCATGAGCCACTGCAGGAAGG + Exonic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078421400 11:11215999-11216021 CAGCAGTGGCAATGGCAGCAGGG - Intergenic
1078425780 11:11250098-11250120 CAGCATGTGCAAAGGCCCTAAGG - Intergenic
1078532682 11:12149155-12149177 CAGCATCAGCAAAGGCATGTGGG + Intronic
1078921728 11:15837018-15837040 CAGCAGGTGCAAAGGCCTCAGGG + Intergenic
1079081080 11:17414253-17414275 CAGCTAGAGAAAAGGCAGCGGGG + Intronic
1079088966 11:17467491-17467513 CAGCATGTGCAAAGGCCCCAAGG - Intronic
1079131741 11:17750696-17750718 CGGAATAAGCAAAGGCAGAAGGG - Intronic
1079170710 11:18092639-18092661 AAGTATCAGCAAAGGCAGGAAGG + Intronic
1079241967 11:18727831-18727853 CAGCATGAGCACAGTGAGCTTGG - Intergenic
1079290155 11:19180813-19180835 CAGCATTAGCAAAGACATGATGG + Intergenic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079523412 11:21355915-21355937 CAGCAAGTGCAAAGGCCCCAAGG - Intronic
1080109326 11:28547757-28547779 CCTCAGGAACAAAGGCAGCAGGG - Intergenic
1080469207 11:32528685-32528707 CAGCATGTGCAAAGGCCCAATGG - Intergenic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081620192 11:44614825-44614847 CAGCAGGTGCAAAGGCCCCAAGG + Intronic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1082759176 11:57109854-57109876 CAGCATGTGCAAAGACATCAGGG - Intergenic
1083253786 11:61484404-61484426 CAGCAAGTGCAAAGGCCTCAAGG + Intronic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083755139 11:64788263-64788285 CAGCTGGAGCAAAGGCCCCATGG - Intergenic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084691942 11:70732638-70732660 CAGCAGGTGCAAAGGCCCCATGG - Intronic
1084754341 11:71225420-71225442 CGGCATTAGTATAGGCAGCATGG + Intronic
1084798835 11:71527685-71527707 CAGCCTGAGGAACAGCAGCAGGG - Exonic
1084851084 11:71941243-71941265 GAGCTTGAGCAAAGACAGTAGGG + Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085041247 11:73327637-73327659 CAGCATGTGCAAAGGGCCCAGGG + Intronic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085295235 11:75427758-75427780 CAGTATGGGCAAAGGCACAAGGG - Intronic
1085337122 11:75704825-75704847 CAGCATGAGCAAAGGCCCTCAGG + Intergenic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085410028 11:76285406-76285428 CAGCATGAGGAAAGGCAAGATGG - Intergenic
1085702055 11:78754446-78754468 CAGCCTGATCAATGCCAGCAGGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086221494 11:84450434-84450456 CAGCAGGAGCAAAAGCAAGAAGG + Intronic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087152618 11:94872355-94872377 AAGCATGAGCAAAGGGAACTGGG - Exonic
1087678070 11:101185441-101185463 AAGCAAGACCAGAGGCAGCAAGG + Intergenic
1088651068 11:111958506-111958528 CAGAGGGAGCTAAGGCAGCAGGG - Intronic
1088947253 11:114526679-114526701 CGTCATGAGCAAAGTCATCATGG - Intronic
1089407766 11:118212688-118212710 AGGCATGTTCAAAGGCAGCATGG + Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089622719 11:119730793-119730815 CAGCACGAGCAAAGGAATGAAGG + Intergenic
1089784990 11:120901342-120901364 CAGCATGTGCCAAGGCAGGGAGG - Intronic
1090249465 11:125241294-125241316 CAGCATGTGCAAAGGCACCGAGG - Intronic
1090857817 11:130625717-130625739 GAGCATGAGGAAAGTCAGCAAGG + Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091307184 11:134543792-134543814 CAGCATGTGCAAAGGCCCCGGGG - Intergenic
1091404774 12:202392-202414 GAGGCTGAGCAAAAGCAGCAGGG - Intronic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1092918165 12:13206860-13206882 CTGCCTGAACAAAGGCAACAAGG + Intronic
1094070065 12:26403163-26403185 CAGGATGAGCAAAGGCAAACAGG + Intronic
1094166252 12:27446870-27446892 CAGCATCAGCAAAAGCATCAGGG - Intergenic
1094413388 12:30191735-30191757 CAACAGAAGCAAAGGCTGCAGGG - Intergenic
1094702174 12:32880442-32880464 CAGCATGATCAAGGGAAACATGG + Intronic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095963603 12:47851537-47851559 CAGCAAGATCAAAGCCACCAGGG + Intronic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096546643 12:52344714-52344736 CAGGAGGAGCAAGGACAGCAGGG + Intergenic
1096680692 12:53253336-53253358 CAGCTCGAGCAAAGGTAGCTGGG - Exonic
1096750025 12:53752590-53752612 CAGATTGAGGAAAGGCAGAAGGG - Intergenic
1096799932 12:54103731-54103753 CAGCATGGGCAAAGGCCCCAAGG - Intergenic
1097252599 12:57645184-57645206 CAGGATGAGCAAGGGCAGTTTGG + Intergenic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1098471946 12:70855365-70855387 CAGCCTCAGCTAGGGCAGCAGGG + Intronic
1099420667 12:82455628-82455650 CTGCATGAGCAAATGTACCAAGG + Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101129686 12:101675936-101675958 CAGCATGTGCAAATGCGGAAAGG + Intronic
1101223343 12:102663075-102663097 CAGCAGTTGCAAAGGCAGAAAGG - Intergenic
1101406346 12:104432523-104432545 GAGCAGGAGAAAAGGCAGGAGGG - Intergenic
1101617663 12:106354067-106354089 CAGCGTGAGCAATGGCATGAGGG - Intergenic
1102179605 12:110902436-110902458 CAGCCTGTGCAAAGGCCCCAAGG - Intronic
1102430342 12:112878214-112878236 CAGGATGAGGGAAGGCAGAAGGG - Intronic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1103028463 12:117593073-117593095 GAGCATGTGCAAAGGCAGCTTGG + Intronic
1103189762 12:118991276-118991298 CAGCATGTGCAAAGGCTCCATGG - Intronic
1103256204 12:119543578-119543600 CAGCATGTGCAAAGGCCGAGAGG + Intergenic
1103732723 12:123038650-123038672 CAGCGTGAGCAAAGGCCCCAGGG + Intronic
1103732797 12:123039063-123039085 CAGCGTGAGCAAAGGCCCCAGGG + Intronic
1103845582 12:123899938-123899960 CAGCATCAAAACAGGCAGCAGGG - Intronic
1103962362 12:124617121-124617143 CTGCATGTGCAAAGGCCCCAGGG - Intergenic
1104426165 12:128679983-128680005 CAGCAAGTGCAAAGGCCCCAGGG + Intronic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104738862 12:131157967-131157989 CAGCATGTGCAAAGGCCCCGAGG - Intergenic
1104925392 12:132311394-132311416 CAGCACGGGCAGGGGCAGCAGGG + Intronic
1105344231 13:19559569-19559591 GAGGAGGAGCAAAGGGAGCATGG + Intergenic
1105535800 13:21262005-21262027 GAGGAGGAGCAAAGGGAGCATGG - Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106307412 13:28525664-28525686 CACCAGGAGAAAAGACAGCAAGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1108747735 13:53412078-53412100 CAGCTTGAGCAAAGGCATCTAGG + Intergenic
1108894858 13:55313471-55313493 CATCAGGAGCAAAGGAAGTAGGG - Intergenic
1109175538 13:59150828-59150850 CAGCATGAACAAAGTCAAGAAGG + Intergenic
1109461015 13:62657389-62657411 CAGCCTGAGCCAGGGCTGCAAGG + Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1110391960 13:74984370-74984392 CAGCAATAGCAAAGGCCTCAAGG - Intergenic
1110646290 13:77888686-77888708 CAACATAAGCAAAGTCAGAAAGG - Intergenic
1111379389 13:87426902-87426924 CATAATGAGCAAAGGAAGTATGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111784780 13:92772418-92772440 CAGCAAGTGCAAAGGCCCCATGG - Intronic
1112140432 13:96635398-96635420 CAGCATAAGCTAAGGCAGAAGGG - Intronic
1113221699 13:108111817-108111839 CACAATGAGGAAAGGCAGAATGG - Intergenic
1113281236 13:108790061-108790083 TAGCATAAGCAAAGGCAAGAAGG + Intronic
1113926319 13:113943773-113943795 CAACGTGAGGGAAGGCAGCAGGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114517992 14:23312515-23312537 CAGGACCAGCAAAGGAAGCAGGG - Intronic
1114658914 14:24332624-24332646 CCGCATGCCCAAGGGCAGCATGG + Exonic
1115032347 14:28812051-28812073 CAGGATGAGCAAAGAAAGAAGGG + Intronic
1115604196 14:34983708-34983730 TAGCATGAAGAAAGGCAGCAGGG - Intronic
1115708858 14:36028022-36028044 CAGCAAGAGTAGAAGCAGCAGGG - Intergenic
1116114759 14:40633384-40633406 GAGCACAGGCAAAGGCAGCATGG + Intergenic
1116621373 14:47208245-47208267 CAGCAAAAGCAAAGGTAGCCAGG + Intronic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117555218 14:56876936-56876958 CAGCATGTGCAAAGGTAGGAAGG + Intergenic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118317871 14:64736820-64736842 AAGCATGAGCAGAGTCAGCGCGG - Intronic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1119172869 14:72547796-72547818 GAGCATGAGCAACAGCACCATGG + Intronic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120699578 14:87684108-87684130 AAGCAAGAGCAAGGGCAGTAGGG + Intergenic
1120892536 14:89504101-89504123 CAGGATGAGCAAAGCTAGCTGGG - Intronic
1121174224 14:91878652-91878674 CAGCATGTGCAAAGGCGAGAAGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121577235 14:94998239-94998261 CAGCAAGGTCAAAGGCAACATGG - Intergenic
1121665586 14:95669725-95669747 CAGCATACGCAAAGGCAGAAAGG - Intergenic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122249395 14:100427423-100427445 CAGCTTGATCACAGTCAGCAGGG + Intronic
1122755139 14:103972609-103972631 CAGCTTGATAAAAGGCCGCATGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1123144017 14:106110561-106110583 TAAAATGAACAAAGGCAGCAAGG + Intergenic
1123192065 14:106580967-106580989 TAAAATGAGCAAAGGCACCAGGG + Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1124492309 15:30165537-30165559 CAGCATGTGCAAAGGCCCCGAGG - Intergenic
1124751226 15:32372780-32372802 CAGCATGTGCAAAGGCCCCGAGG + Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126205033 15:46035770-46035792 CAGCTTGAGCTAAGTCAGCAAGG + Intergenic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1127104464 15:55598150-55598172 CAGCATTAGCAAAGCCACCGTGG - Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127671452 15:61198929-61198951 GAGCCTCAGCAAAGGCAGGAAGG - Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128484569 15:68072004-68072026 CAGCATGAGCAAAGGTAATGAGG + Intronic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129774692 15:78228803-78228825 CAGCATGTGCAAAGGCCCCGAGG - Intronic
1130438463 15:83926220-83926242 CAGTATGTGCAAAGGCCCCAAGG + Intronic
1130556753 15:84928183-84928205 CAGAATGGGCAGAGGCAGCCAGG + Intronic
1130717333 15:86348108-86348130 CAACAGGAGGAAAGCCAGCATGG - Intronic
1130739867 15:86587560-86587582 CAGTATAAGCAAAGGCATAAAGG + Intronic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131676256 15:94673724-94673746 CATCATGTGCAAAGACAGCCGGG - Intergenic
1131782074 15:95870599-95870621 CAGAATAAGCAAAGGTTGCAAGG + Intergenic
1132046173 15:98564493-98564515 CAGCCTGAGCTGAGGCATCAGGG + Intergenic
1132252131 15:100341864-100341886 CAGGACGAGCGGAGGCAGCAGGG + Exonic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1133148244 16:3806815-3806837 CACCATGAGGGAAGGGAGCAGGG - Intronic
1133468122 16:6047541-6047563 CAGCAAGGGCAGAGCCAGCAGGG + Intronic
1133757957 16:8776625-8776647 CAGCATGTGCAAAGCCCCCAAGG - Intronic
1133815875 16:9196998-9197020 CAGCATGAGCAAAGGCCCCAGGG + Intergenic
1134031704 16:10997160-10997182 CAAGATGAGCACAGGAAGCATGG - Intronic
1134144920 16:11753138-11753160 CACCATGAGGAAAAGCAGAAAGG + Intronic
1134235599 16:12463074-12463096 CAGCATGGGCAGCAGCAGCAGGG - Intronic
1134752437 16:16636647-16636669 CAGCAAGTGCAAAGGCCACAAGG - Intergenic
1135340196 16:21638778-21638800 CAGCATGTGCAAAAGCATGAAGG + Intronic
1135609585 16:23854592-23854614 GGGCATGAGCAAGGGCTGCAGGG + Intronic
1136170689 16:28487474-28487496 CAGAATGAGAAAAGGCAACCAGG + Exonic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1137920780 16:52486252-52486274 GAGCCTGAGAAAGGGCAGCAAGG + Intronic
1138337663 16:56265956-56265978 CAGCAAGAGCAAAGGCCCCGGGG - Intronic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139469677 16:67171422-67171444 CAGCATCAGCAAAGGCTCCGAGG + Exonic
1139526132 16:67518054-67518076 CAGCATTAGCAAAGGCCCAAGGG + Intergenic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1141208713 16:81956597-81956619 AAGCATGCCCAAAGGGAGCATGG - Intronic
1141298698 16:82793208-82793230 GAGCATTTGCAAGGGCAGCATGG + Intronic
1141712991 16:85710710-85710732 CAGCATATGCAAAGGCACGAAGG - Intronic
1142590876 17:1005404-1005426 CAACATTTGCACAGGCAGCAAGG + Exonic
1142693298 17:1619969-1619991 CTGCCTGAGTAAAGGCACCAGGG + Intronic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143993914 17:10990483-10990505 CAAGATGAGTAAAGGAAGCAGGG - Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145305434 17:21671716-21671738 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1145887229 17:28390813-28390835 CAGCATGAGCAAAGGAATAAAGG + Intronic
1146398964 17:32488807-32488829 CAGCAAGGGCACAGGCGGCAGGG - Exonic
1146604823 17:34249258-34249280 CAGCATGGGCAAAGGCCTCAAGG + Intergenic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146668466 17:34720652-34720674 CAGCATATGCAAAGGCACCAAGG + Intergenic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1147225314 17:38971997-38972019 TAGCATGAACAAAGCCACCAGGG - Intergenic
1147462351 17:40581428-40581450 CAACATCAGTAAAGGCAGCCTGG - Intergenic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147980760 17:44272649-44272671 CAGCCTGAGCCAAGGCAGCAGGG + Intergenic
1148202390 17:45757934-45757956 CAGCAAGTGCAAAGGCCCCAGGG + Intergenic
1148910308 17:50938993-50939015 CAGCAGGTGCAAAGGCCCCAAGG + Intergenic
1148935299 17:51160402-51160424 CAGCATGTGCAAAGGTCCCAGGG + Intronic
1149450787 17:56748409-56748431 CAGCAGGAGGGAAGGCAGGAAGG - Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149865606 17:60149623-60149645 CAGAATGATCAAAGTCATCATGG + Intergenic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1151345913 17:73500977-73500999 CTTCATCAGCAAGGGCAGCATGG - Intronic
1151944870 17:77314138-77314160 CAGCCTGGGCAAAGGGAGTAAGG + Intronic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152330268 17:79668756-79668778 CAGCAGGAGCAAGAGCAGCTTGG - Intergenic
1152330930 17:79672654-79672676 CACCATGCTCAGAGGCAGCAAGG - Intergenic
1152430979 17:80248205-80248227 GAGCATGAGCAGAGACACCAGGG - Exonic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152742815 17:82025802-82025824 AAGCATCAGCAAAGCCACCAAGG - Intronic
1154165248 18:12009844-12009866 CAGCCTGAGAAAATGCACCAAGG - Intronic
1155018108 18:21866220-21866242 CAGGACTTGCAAAGGCAGCAAGG - Exonic
1155316035 18:24570992-24571014 CAGCATGGCCAAAAGCAGAAGGG - Intergenic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1157515800 18:48310490-48310512 AAGCATGAGGAAAGACAGAAAGG - Intronic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157692480 18:49694866-49694888 CAGCATGAGAATATGTAGCAGGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1157995306 18:52547736-52547758 CAGCATGAGCAAAGGAACAAAGG + Intronic
1158138610 18:54232575-54232597 CAGCAGGAGCAAGGGCAAAAGGG - Intergenic
1158305018 18:56095696-56095718 CTTCATGAGCAAAGGGAGAATGG - Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159484519 18:69037634-69037656 GAACATGAGCAAAGGCATGAGGG + Intronic
1159758561 18:72395854-72395876 CACCATGGTCAGAGGCAGCAAGG + Intergenic
1159961105 18:74556345-74556367 CAGCAGCAGCACAGCCAGCAGGG - Exonic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1160760070 19:779393-779415 CAGCATGAGCCACGGGAGCCAGG + Intergenic
1160976379 19:1794706-1794728 CAGCATGTGCAAAGGTGCCAAGG + Intronic
1161207583 19:3049418-3049440 CAGCATGTGAAAAGGCCTCAAGG + Intergenic
1161501337 19:4617731-4617753 CAGCATGGGCAAAGGCCGGGTGG - Intergenic
1161669498 19:5597634-5597656 CAGCTTGAGGAGATGCAGCACGG - Intronic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162436098 19:10660090-10660112 CAGCATGCTCTCAGGCAGCAGGG - Intronic
1163268215 19:16234067-16234089 CAGGATGAGCACAGGCCTCAGGG - Intronic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163518274 19:17778060-17778082 CAGCATGTGCAAAGGCCCCAGGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164411852 19:28012713-28012735 CAGCATCTGCAAAGGCCCCATGG - Intergenic
1164711014 19:30357306-30357328 CAGCATGTGCAAAGGCCTCATGG + Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1166542133 19:43612415-43612437 CAGGACCAGCAAAGCCAGCAAGG + Exonic
1166991353 19:46694690-46694712 CAGCATGTGCAAAGGCCCTAAGG + Intronic
1167266125 19:48483589-48483611 CTGCATGAACCAAGGCAGCGGGG - Intergenic
1167338767 19:48902781-48902803 CAGCATGAGCAAAGGCCACTTGG + Intronic
1167683312 19:50939468-50939490 CACCATGACAAAAGGCAGGAAGG - Intergenic
1168010387 19:53526253-53526275 CAGCATGACCAAACCCAACAAGG - Intronic
1168102442 19:54148354-54148376 CAGCCTGGGCATAGGGAGCAGGG - Exonic
1168308126 19:55447110-55447132 CAGCACGTGCACAGGCAGGAAGG - Intergenic
1168357414 19:55710628-55710650 GAGCAGGAGGAAAGGAAGCAGGG - Intronic
1202713669 1_KI270714v1_random:30669-30691 CAGCATGGGCAATGTAAGCAGGG - Intergenic
925742021 2:7014143-7014165 AAGCAAGATGAAAGGCAGCAAGG - Intronic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
925797910 2:7566793-7566815 GAGCATGTGCAAGGGCAGAAAGG - Intergenic
926241992 2:11095664-11095686 CAGCAGGTGCAAAGGCACTATGG + Intergenic
926386260 2:12338478-12338500 CAGCAAGAGCAGGGGAAGCAGGG - Intergenic
926414299 2:12633897-12633919 CTGCATGAACAAAGATAGCAAGG + Intergenic
926787909 2:16536672-16536694 CAGCATGTGCTAAGGCAGGAAGG + Intergenic
926787976 2:16537347-16537369 CAGCATGTGCTAAGACAGGAAGG - Intergenic
926940395 2:18129959-18129981 GAGCATGGGCAAAGGCACCAAGG - Intronic
927082375 2:19643202-19643224 CAGTTTCACCAAAGGCAGCATGG - Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927877441 2:26668197-26668219 CAGCATGAGAAAAGGTACCGTGG + Intergenic
928100167 2:28432171-28432193 AAGCATGAGAAAAGGAGGCAGGG - Intergenic
928855775 2:35801023-35801045 CAGTGTAAGAAAAGGCAGCAAGG - Intergenic
929295547 2:40242427-40242449 CAACATAAACACAGGCAGCATGG - Intronic
929653513 2:43706023-43706045 CAGCCTGAGCAAAGCATGCATGG + Intronic
929868549 2:45738397-45738419 AGGCATGAGCAAAGGCAGAGAGG - Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929937276 2:46302562-46302584 CATCATGTGAACAGGCAGCATGG - Intronic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930233015 2:48861600-48861622 GAGCATGAGCAAAGGCACAACGG - Intergenic
930366006 2:50440148-50440170 CAATATGAGCAATGACAGCAAGG + Intronic
930664724 2:54090662-54090684 CAGGATTGGCAAAGGCAGGAAGG - Intronic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931260736 2:60616183-60616205 GAACATGAGCAGAGGCACCAAGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
932670220 2:73731082-73731104 AAGCTTGAGCACAGGCAGAAGGG - Intronic
932782594 2:74570664-74570686 CAACATGAGCAAAGGCTCAAAGG + Intronic
932803400 2:74762559-74762581 CAGGAGGACTAAAGGCAGCAAGG - Intergenic
932823139 2:74918438-74918460 CAGCAGGAGGCAAGGCAGAATGG + Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933409682 2:81909891-81909913 CAGGATGTGCAAAAGGAGCATGG + Intergenic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934111724 2:88749714-88749736 CAGCATGAACAAAGGCCTCAGGG + Intronic
935161492 2:100533301-100533323 CACAGTGAGCAAAGGCACCAAGG - Intergenic
935199045 2:100840077-100840099 CAGTATGAGCAAAGGCCCCGGGG - Intronic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936380923 2:111985265-111985287 CAGCAGCAGGAAAGGCAGCTGGG + Intronic
937013448 2:118582339-118582361 CTCCACGTGCAAAGGCAGCAGGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937491508 2:122372752-122372774 TAGCAGGAGAAAAGGAAGCAAGG + Intergenic
937504477 2:122521252-122521274 CAGTATGAAGAAAGTCAGCAGGG + Intergenic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
938923008 2:136012425-136012447 AAGCACGAGCAAAGGCAGAGAGG - Intergenic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939255423 2:139738118-139738140 CAGAATTAGCAATGTCAGCAGGG + Intergenic
939489056 2:142855028-142855050 CTGCAAAAGCAAAGACAGCAGGG - Intergenic
939609681 2:144295189-144295211 CAGCATGTGCAAAGGCCACGTGG - Intronic
939960632 2:148562060-148562082 AACCAGCAGCAAAGGCAGCATGG - Intergenic
940337751 2:152546596-152546618 CAGCAGAAGCAAAGGCTGCAGGG + Intronic
941067804 2:160922757-160922779 AAGTATGAGCAAATGCTGCAAGG + Intergenic
941675927 2:168343723-168343745 CAGAATGAGAAATGGCAGCCAGG + Intergenic
941791315 2:169554952-169554974 CAGCATGGGCACTGGCAGAATGG + Intronic
942088218 2:172462923-172462945 CAGCATATGCAAAGGCTGCAAGG - Intronic
942408850 2:175685351-175685373 CAGCATGAGCAAAGGAAGAAAGG - Intergenic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
943151180 2:184115615-184115637 TAGCTTGAGCAGAGGCAACAAGG + Intergenic
943151296 2:184116698-184116720 CAGCTTGGGCAATGGCAACAGGG - Intergenic
944657447 2:201890306-201890328 CAGCATGAGCAAAGATATGAAGG - Intronic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
946229420 2:218282363-218282385 AAGCAGGCGCAAAGGCAGGAGGG - Intronic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946927893 2:224643862-224643884 CAGGATCAGCACAGGCAGCCAGG - Intergenic
947425641 2:229980741-229980763 CAGCAGGAACACAGCCAGCAGGG - Intronic
947933695 2:233985169-233985191 CAGCATGGGCAAAGGCCCCGTGG - Intronic
948272610 2:236686206-236686228 CAGCATGAGCAAGGGAGGCGGGG - Intergenic
948544931 2:238720728-238720750 AAGCATGAGGCAAGGCAGGAGGG + Intergenic
948777501 2:240297283-240297305 GAGCATAAGCTAAGCCAGCAAGG + Intergenic
949030506 2:241794687-241794709 CCCCCAGAGCAAAGGCAGCAGGG + Intronic
1168836552 20:881517-881539 CAGCATATGCAAAGGCCCCAAGG + Intronic
1169802413 20:9523699-9523721 CACCAAGAGCAAAGGCATGAGGG + Intronic
1169846843 20:10003149-10003171 CAGCAAGGGCAAAGGCAGAGAGG - Intronic
1170527898 20:17259739-17259761 CAGCCTGATAAAAGGCACCAAGG + Intronic
1170621428 20:17999706-17999728 CAGCATGTTCAAAGGCCCCAGGG + Intronic
1171020399 20:21579475-21579497 CAACATGACCTAAGGCACCAGGG + Intergenic
1171227931 20:23456809-23456831 CTGCATCATCAAAGCCAGCATGG + Intergenic
1171522944 20:25789187-25789209 CAGCTTGAGCCAAGTCAGGATGG - Intronic
1171530688 20:25851156-25851178 CAGCTTGAGCCAAGTCAGGATGG - Intronic
1171553883 20:26066696-26066718 CAGCTTGAGCCAAGTCAGGATGG + Intergenic
1171796513 20:29570612-29570634 CAGCATGGGCAAAGGCCGCAAGG + Intergenic
1171851730 20:30313558-30313580 CAGCATGAGCAAAGGCTGCAAGG - Intergenic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172587908 20:36097730-36097752 TAGCATGTGCAAAGGCAGAACGG + Intronic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172637094 20:36417257-36417279 CAGCATGGGCAAAGGCCCCATGG + Intronic
1172776375 20:37409557-37409579 CACCATGAGCAATGCCTGCATGG - Intergenic
1172783765 20:37452392-37452414 CAGCTTGAGCAAAGGCCAGAAGG - Intergenic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173791447 20:45830387-45830409 CAGCATGTGCAAAGGCTTGAAGG - Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174177030 20:48651681-48651703 CAGCAAGTGCAAAGGCCCCAGGG + Intronic
1174179126 20:48664015-48664037 CAGAATGAACAAAGACAGAAAGG + Intronic
1174384767 20:50180687-50180709 CAGCATGTGCAGAGGCCACATGG + Intergenic
1174680086 20:52398314-52398336 CAGCTTGAGCCAAGGGAGCTGGG + Intergenic
1175712339 20:61231401-61231423 CAGCATGGGGAATGGGAGCAGGG - Intergenic
1175800721 20:61799797-61799819 GAGCATCAGTGAAGGCAGCACGG - Intronic
1175866765 20:62182887-62182909 AAGCAGGAGCAACGGCAGGAGGG - Intergenic
1176241151 20:64076543-64076565 CAGCACCAGCACAGGCAGCAGGG + Exonic
1176256596 20:64156259-64156281 CAGCATGAGTGAAGGCCGCAGGG - Intronic
1178140839 21:29681540-29681562 AGGCTTGAGCAAAGGCTGCAAGG - Intronic
1178522475 21:33298008-33298030 CAGCTTGAGCAAAAGCAGTCTGG + Intergenic
1178580272 21:33832165-33832187 TGTCATGAACAAAGGCAGCAAGG - Intronic
1178677338 21:34642384-34642406 CAACATGACCAAAGGCAGGTGGG - Intergenic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179166308 21:38937859-38937881 TCACATGAGCAAAGGCAACAGGG - Intergenic
1179591961 21:42414899-42414921 CAGCATGAACCCAGGCAGCATGG - Intronic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181079075 22:20401736-20401758 CAGCATGAGCATCAGCATCAGGG + Intronic
1181265346 22:21627962-21627984 CAGCATGAACAAAACCAGAATGG + Intergenic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181332535 22:22104501-22104523 GAGCAAGATCAAAGGCAACAGGG + Intergenic
1182127886 22:27829402-27829424 CAGCATGAGGAAGGGCACAAAGG + Intergenic
1182356525 22:29724651-29724673 CAGCACAGGCAAAGGCACCAAGG + Intronic
1182397370 22:30046126-30046148 CAGCATGGGATCAGGCAGCAGGG - Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182557541 22:31137349-31137371 CAGCATGTGCAAAGGCCTCACGG + Intronic
1182765432 22:32754718-32754740 CCGAAGGAGCAAAGGCATCAAGG - Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183673116 22:39284423-39284445 CATCATTAGCAGAGCCAGCAAGG - Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1183950140 22:41348090-41348112 GATCATCAGCAAAGGCACCAAGG + Exonic
949123155 3:412212-412234 CAGCGTGAGACAAGGGAGCAGGG - Intergenic
949379723 3:3431289-3431311 CAGCATGTGCAAAGGCTCCTGGG - Intergenic
950124789 3:10504682-10504704 CAGGATGGGAAAATGCAGCAGGG - Intronic
950457203 3:13099860-13099882 CGGCATGTGCAAAGGCCCCAAGG + Intergenic
950548036 3:13650450-13650472 CAGCATGCTCAAAGGCACGAAGG + Intergenic
950626153 3:14248615-14248637 CAGCACATGCAAAGGCACCAAGG - Intergenic
950635203 3:14309174-14309196 CAGCAAGAGCAAAGACAGGGAGG + Intergenic
950745186 3:15082489-15082511 CAGCATGAGCAGTGTCAGCTCGG - Exonic
950836269 3:15922385-15922407 AAGCATGAGCCAAGGCACCCAGG - Intergenic
950851819 3:16069515-16069537 CAGCATCAACAAAGACATCAAGG + Intergenic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
950983256 3:17331817-17331839 CAGCATGTACAAAGGCTCCATGG + Intronic
951066466 3:18272525-18272547 CAGCACGTGCAAAGGCTGCAAGG - Intronic
951270303 3:20616299-20616321 CAGCATTTGCAAAAGCAGAAAGG - Intergenic
951275429 3:20679398-20679420 TAGCATGTGCAAAGGCAGAGAGG + Intergenic
951924234 3:27889427-27889449 CAGCGTGAGCAAAGTCAACAGGG - Intergenic
952367772 3:32689991-32690013 CATAGGGAGCAAAGGCAGCATGG + Intronic
953596511 3:44319152-44319174 CAGCATGGGATCAGGCAGCAGGG - Intronic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954420860 3:50418405-50418427 TAGCACAAGCAAAGGCAGGAAGG - Intronic
954681253 3:52347250-52347272 CAGCATGGGCAGAGGCACCGAGG + Intronic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
955065627 3:55531490-55531512 TAGCATGAAAAATGGCAGCAAGG - Intronic
955812277 3:62803907-62803929 CAGCCTGTGCAAAGGCCCCACGG - Intronic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
956111980 3:65878976-65878998 CAGCAGGAGCTCAGGCAGCAGGG - Intronic
956153362 3:66267278-66267300 CAGCAAGAGCAAAGCCATAAGGG + Intronic
956480572 3:69669881-69669903 CAGCAAATGCAAAGGCACCAAGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957011623 3:75012179-75012201 CACCATGAGCAAAAGCTCCATGG + Intergenic
957227273 3:77465948-77465970 CAGCAGGAGAAGAGGAAGCAAGG - Intronic
957321424 3:78635869-78635891 CAACATGAACAATGGCAGCGGGG - Exonic
957518923 3:81294081-81294103 GAGCATGAATAAAGGCATCAAGG - Intergenic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958896524 3:99835921-99835943 CAGCATGATCAAAGGTAAGAAGG + Intronic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
960623797 3:119660878-119660900 CAGAATGAGGAGAGCCAGCATGG + Intronic
960642940 3:119845886-119845908 CGGCATCAGCAAAGGCTACAAGG + Intronic
960758687 3:121048977-121048999 CAACAGGAGCAAGGGCTGCAGGG + Intronic
961658524 3:128456325-128456347 CAGCATCTGCAAAGGTAGAAGGG + Intergenic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962491798 3:135901807-135901829 CAGCATGAGCAAAGATAAGAAGG + Intergenic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
962701090 3:138000375-138000397 CAGCATGGGCAAAGCCATGAGGG + Intronic
963163525 3:142177262-142177284 CAGCACAAGCCAAGCCAGCAGGG + Intronic
963489238 3:145978240-145978262 TAGCATGAGCAAAGGAAGACAGG - Intergenic
963853953 3:150235293-150235315 CAGCATGGGCAAAGGCAGATTGG - Intergenic
964394730 3:156233624-156233646 CAGCAAGGGCAAAAGCAGAAAGG + Intronic
964524677 3:157605878-157605900 GAGCATGAGAAAATGTAGCATGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
965075571 3:163970973-163970995 GAGCATGGGCCAAGGGAGCAGGG + Intergenic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
965789461 3:172372281-172372303 CTTCATGGGCACAGGCAGCAGGG + Intronic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966747978 3:183296431-183296453 CAGCATGTGCAAAGGCTTCAGGG - Intronic
966959435 3:184919102-184919124 CAGCATGAGCAAAGGTACTTTGG + Intronic
967710598 3:192702761-192702783 CAGCCTGAGCAAGGGAAACAGGG + Intronic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969377381 4:6771777-6771799 CAGCATTTGCAAAGGCAGAGAGG + Intergenic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969581795 4:8069511-8069533 CGGCATGAGGCAAGGCAGGAAGG + Intronic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
970590923 4:17560212-17560234 CAGCATGGGCAACGAGAGCAAGG - Intergenic
971087499 4:23295989-23296011 CAGCAAGAGCAAAGGCCATAGGG + Intergenic
971511933 4:27437127-27437149 TAGGATGAGCAAAGGCATGAAGG + Intergenic
971834703 4:31748282-31748304 CAGAGTGAGCTAAGGCATCAGGG + Intergenic
972270043 4:37502306-37502328 CAGCAGTGGCAGAGGCAGCATGG + Intronic
972386802 4:38574849-38574871 CAGCACGAGCAGAGAAAGCAGGG - Intergenic
973154880 4:46938405-46938427 CTACATCAGCAAAGGCAACAGGG + Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
974718450 4:65702865-65702887 GAGCATGAGCAAAGGAAACTGGG - Intergenic
974923183 4:68267446-68267468 AAGAATGAACAAAGGCAGCTTGG - Intergenic
975487248 4:74948020-74948042 TGGCATGAGCAAAGGCAGAGAGG - Intronic
975739199 4:77412237-77412259 CAGCATGAGCCCAGGCACCAAGG - Intronic
975910215 4:79258516-79258538 CAGAAGGGGCCAAGGCAGCAGGG - Intronic
976836228 4:89377283-89377305 GAGCAAAAGCAAAGGCATCAGGG + Intergenic
978655912 4:111065160-111065182 AAGCATAAACTAAGGCAGCAAGG - Intergenic
980701733 4:136441780-136441802 CAGGAGCAGCAATGGCAGCATGG + Intergenic
980861789 4:138507785-138507807 CAGAAAGAGCAAAGGCATGAGGG + Intergenic
981223320 4:142262370-142262392 TAGCAAGAGCAAAGGCCCCAAGG - Intronic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
982166496 4:152618114-152618136 GAGCATGAGCAAGAGAAGCAGGG - Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983771026 4:171549246-171549268 CAGTATGAAGAAAGGCATCATGG + Intergenic
984875942 4:184367488-184367510 TAGCATGAGCAAAGGCTTGAAGG + Intergenic
984887011 4:184458038-184458060 CAGCAAGAGCAAAGACATGAAGG - Intronic
985426941 4:189840510-189840532 GAGGATGAGCAAGGGCAGCTTGG - Intergenic
985426951 4:189840583-189840605 AAGGATGAGCAAGGGCAGCTTGG - Intergenic
986033056 5:3911151-3911173 GCCCATGAGCAAAGCCAGCAGGG - Intergenic
986167239 5:5285279-5285301 CTGCAGGTGGAAAGGCAGCATGG - Intronic
986248113 5:6029433-6029455 CTGGAAGAGCAAAGGCAGCTGGG + Intergenic
986916048 5:12622682-12622704 CAGCATTGACAAAGGCAGCTGGG + Intergenic
987360918 5:17105723-17105745 CAGCAAGTGCAAAGGCCTCAAGG + Intronic
987833974 5:23136997-23137019 CAGCATCCTCAAAGCCAGCAAGG - Intergenic
988865048 5:35324992-35325014 CAGCAGCAGCAATGGCAGCATGG - Intergenic
988906741 5:35798317-35798339 CAGAATTGGCAAAGGGAGCATGG - Intronic
989265153 5:39464762-39464784 CAACATGAGGAAAGGCAGGAAGG - Intergenic
989413995 5:41152330-41152352 CAACATGAGCAAAGAAACCAAGG - Intronic
989465747 5:41753446-41753468 CAGCATGAACAAAAGCTGAAAGG - Intronic
990347261 5:54883195-54883217 CAGCAAGAGTGTAGGCAGCAAGG + Intergenic
990513462 5:56510578-56510600 CAGAATGAGCAAGGGGGGCAGGG - Intergenic
991473355 5:66993640-66993662 CAGGATGTGCAAAGGCAGTGAGG + Intronic
992332211 5:75729014-75729036 CACCATGGGCTAATGCAGCAAGG - Intergenic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992941162 5:81763443-81763465 CAGCATGTACAAAGGCAAAAGGG + Intergenic
993055623 5:82976037-82976059 CAGAATGAGCCAAGGCAGGCAGG + Intergenic
993178451 5:84518560-84518582 CAGCAGTGGCAGAGGCAGCATGG + Intergenic
994261676 5:97666474-97666496 CAGTATCTGCAAAGGCAGCACGG + Intergenic
994794054 5:104270845-104270867 TAGCATGAGCAAATGCAGAGAGG + Intergenic
997675207 5:135707561-135707583 CAGCAGGTGCAAAGGCTCCAGGG - Intergenic
998538908 5:142960835-142960857 CAGCATGAGCAAAAGTCCCAAGG - Intronic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998625457 5:143840889-143840911 GAGCATCAGTAAAGGCAGCTGGG + Intergenic
998811726 5:145973177-145973199 CAGCATGTGCAAAGGCTCTAAGG + Intronic
999085454 5:148884759-148884781 CAGCATGAGCAAAGACTGAGTGG - Intergenic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
999721531 5:154402299-154402321 GAGCAAGTGCAAAGGCACCAGGG - Intronic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1000371518 5:160541043-160541065 AAACATGAGCAAAGGCATGATGG + Intergenic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001421531 5:171591010-171591032 CAGCACCAGCAAAGGCAAGAAGG - Intergenic
1001592209 5:172873350-172873372 CAGGAAGAGGAAAGGCAGCCAGG - Intronic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001815726 5:174667852-174667874 CAGCATGAGGAAAGGCATTCAGG + Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1001917049 5:175570499-175570521 CAGCATGTGCAAAGGCCCCGAGG + Intergenic
1002045569 5:176539920-176539942 TAGCCTGAGCAAAGGCAGGAAGG - Intergenic
1002062156 5:176631563-176631585 CAGCATGGGCAAAGGCACTGTGG + Intronic
1002130443 5:177078285-177078307 CAGCATAAGCAAAGACGCCACGG + Intronic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003586131 6:7390653-7390675 CAGCAAGAGCAAAGGCCCCGAGG + Intronic
1004037275 6:11935643-11935665 CAGCATGTCAACAGGCAGCAGGG - Intergenic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1004792931 6:19048904-19048926 CAGCAGGCAGAAAGGCAGCAAGG - Intergenic
1004861931 6:19813202-19813224 CAGCCTGAGTAAAGACAGGAGGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005951656 6:30636263-30636285 AGGCATGAGCAAAGGCAGAAAGG + Intronic
1006285294 6:33088704-33088726 CAGCAGGATCAAAGGCAGCCAGG + Intergenic
1006449560 6:34098405-34098427 CAGAAAGAGCAGAGTCAGCAAGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1007289564 6:40775179-40775201 CAGCATGTGCAAAGGCAAGCAGG - Intergenic
1007936980 6:45741165-45741187 CAACATGAGCCAAGGCAAAAAGG - Intergenic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1008087799 6:47262710-47262732 CAGCAGGTGCAATGGCAGGAAGG + Intronic
1008759593 6:54837815-54837837 CAGCATGTGCAAATGCCCCAAGG + Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1009686265 6:66961462-66961484 CAGCATGCCCAAAGGTAGCTAGG - Intergenic
1009975519 6:70667500-70667522 CAGCAAGAGCAAAGGCAAATGGG + Intergenic
1010157847 6:72815452-72815474 AGACATGAGCAAAGGCAGCAAGG + Intronic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1011010117 6:82694421-82694443 AAGCATGACAAAAGGCAGAACGG + Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012417725 6:99027711-99027733 CAGCAAGAGCAAAGGCCGTAAGG + Intergenic
1012744369 6:103065952-103065974 AACCAAGAGAAAAGGCAGCAAGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013722576 6:113048610-113048632 CAGCATGTGCAAAAGCACAAAGG - Intergenic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1015509595 6:134024546-134024568 CAGCCTGAGCAATTGCAGCAGGG - Intronic
1015713535 6:136167028-136167050 CAGCTGGAGCAAAGGCCTCAAGG - Intronic
1016199935 6:141394839-141394861 CAGAGTGGGCCAAGGCAGCAGGG - Intergenic
1016622175 6:146123637-146123659 CACCAAGATCAAAGACAGCAGGG - Intronic
1018057757 6:160067209-160067231 CAGCATGAGCAAAGGGCCCGAGG - Intronic
1018268488 6:162051399-162051421 CCTCATGAGCAAAGCCAGCGTGG + Intronic
1018294982 6:162336047-162336069 CAGGGTAAGCAAGGGCAGCAAGG + Intronic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1019116331 6:169765839-169765861 CAGCATGAGGATTGGCTGCACGG - Intronic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019381107 7:724157-724179 TAGCATGAGCAAAGGCCTCATGG - Intronic
1020434247 7:8145373-8145395 CAGAATGAACAAAGACAGGAAGG - Intronic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1021824540 7:24535834-24535856 CGGCCTGAGCACAGGAAGCATGG - Intergenic
1022323403 7:29308249-29308271 CAGCATGAGCCAAGGGCCCACGG - Intronic
1022438191 7:30410082-30410104 CAGCATGGGCCAAGGCCCCATGG - Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022573340 7:31474503-31474525 CCGCCTGTGCAAAGGCATCACGG - Intergenic
1022967081 7:35483779-35483801 CAGCAGGTGCAAAGGCCCCAAGG + Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023161805 7:37304220-37304242 CACTATGAGCAAAGACACCAGGG + Intronic
1023710990 7:42992349-42992371 AAGCATGAGCAAAGCCCACAAGG - Intergenic
1023912438 7:44565558-44565580 CAGCCTGATCCCAGGCAGCAGGG + Exonic
1024095511 7:45979547-45979569 CAGCATGATCAGGGACAGCAGGG - Intergenic
1024165282 7:46723979-46724001 CAGCAAGGGCAAAGGCTGAAAGG - Intronic
1024954532 7:54902656-54902678 CAGCATGAGGACAGGTACCATGG + Intergenic
1025020250 7:55474886-55474908 CACCAGGAGCCAGGGCAGCAAGG + Intronic
1025215709 7:57054293-57054315 AAGAATGAACAAAGGCAGCTTGG - Intergenic
1025283382 7:57644113-57644135 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1025856682 7:65286452-65286474 CAGCATGGGCAAAGGCCTCAAGG - Intergenic
1026299004 7:69081157-69081179 GAGCAGGAGCAAAGGAACCAAGG - Intergenic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1027144001 7:75681329-75681351 CAGCATGTGCAAAGGCCAGAAGG - Intronic
1027343718 7:77236362-77236384 CAGCAGAGGCAAAGGCATCACGG + Intronic
1027911757 7:84260669-84260691 CAGAGGGAGCCAAGGCAGCAGGG - Intronic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029745354 7:102513096-102513118 GAGCAGGAGCAAAGGCTCCAGGG - Intronic
1029763292 7:102612075-102612097 GAGCAGGAGCAAAGGCTCCAGGG - Intronic
1029935818 7:104423164-104423186 TAGGATGGGCAGAGGCAGCAGGG + Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030060992 7:105621177-105621199 CAGCAGGAGCAAAAGCTTCAAGG - Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1030803255 7:113880485-113880507 CAGCAAGTGTAAATGCAGCAAGG - Intronic
1031829748 7:126612367-126612389 TAGCCTGAGCAAAGACAGAATGG - Intronic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1034203642 7:149297747-149297769 CAGCCTGGGCAAGGGCAACATGG - Intergenic
1035081729 7:156221921-156221943 TAACAGGAGCAGAGGCAGCATGG - Intergenic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035583838 8:757058-757080 CAGCATGTGCAAAGGCCCCATGG - Intergenic
1036223512 8:6940133-6940155 AAGCATGAGCTAAGAAAGCACGG + Intergenic
1036497510 8:9282889-9282911 AAGCATCAGCAAAGTGAGCAGGG + Intergenic
1036537484 8:9664253-9664275 CAGCATGTGCAAAGACGACATGG + Intronic
1037187582 8:16082345-16082367 ATGCAGGAGCAAAAGCAGCACGG + Intergenic
1037193424 8:16155768-16155790 AGGCATGAGGAAAGGCAGGAAGG + Intronic
1037752748 8:21693293-21693315 CAGCATCAGGACAGACAGCACGG + Exonic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1038609137 8:29043251-29043273 CAGCATGTGCAAAGGCAAAATGG - Intronic
1038694082 8:29790237-29790259 GAGCATGAGTAAGGGCTGCAGGG - Intergenic
1039000332 8:32972892-32972914 CAGCTTGAGCAAAGGCTCCAGGG + Intergenic
1039428274 8:37505132-37505154 CAGCATCAGCAACGGCTCCAAGG + Intergenic
1039910496 8:41823024-41823046 GAGCATGAGCGGAGGCAGAAGGG + Intronic
1040434772 8:47379798-47379820 CACAAGGAGCAAAGGCAACAGGG - Intronic
1042013761 8:64283728-64283750 CAGCAAAAGCCAAGGCAACAAGG + Intergenic
1042471720 8:69197130-69197152 CAGCATAAGCAAAGACAGTGGGG - Intergenic
1042813716 8:72854778-72854800 TAGCATGTGCAAAGGCACCGTGG + Intronic
1042976938 8:74479840-74479862 CAGCAAGAGCAGAGGCTGTAGGG + Intronic
1043087222 8:75849684-75849706 CAGAGTGTGCCAAGGCAGCACGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043769640 8:84182806-84182828 CAGCAGAGGCAAAGGCAGCTTGG + Intronic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1044213405 8:89578869-89578891 CAACATGAACAAAAGCATCAAGG + Intergenic
1045293139 8:100850798-100850820 CAGCATCAGCAAAAGCTGCCTGG - Intergenic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1045939896 8:107727313-107727335 CAACTTGACCAAAGACAGCATGG + Intergenic
1046548444 8:115681480-115681502 CAGCAGGTGCAAAGGCCGAAAGG - Intronic
1046742396 8:117843516-117843538 TAGCAGGAACAAAGGCACCAAGG + Intronic
1046794336 8:118354416-118354438 TAGCATGAGCAAAGGCTGGGAGG - Intronic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047432049 8:124801122-124801144 AGGCATGAGCAAAGGGGGCAGGG + Intergenic
1047825597 8:128570937-128570959 CAGCATAAGTAAAGGCATCATGG + Intergenic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048128358 8:131663038-131663060 CAGCAGGAGCCAGGGCACCATGG + Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048517967 8:135127615-135127637 CAGCATGTGCATGGGCCGCAGGG - Intergenic
1048592873 8:135837704-135837726 CAGCAAGTGCAAAGGCCCCAAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049499386 8:142953442-142953464 GAGCCTGGGCAGAGGCAGCAGGG - Intergenic
1049593279 8:143472164-143472186 CAGCCTCAGCAACGCCAGCAAGG - Intronic
1049953013 9:663729-663751 CAGCTGGAGCAGAGCCAGCACGG + Intronic
1050245543 9:3685828-3685850 TACTATGAGCAAAGGCATCAAGG + Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051205164 9:14680994-14681016 CAGAATAAGCAAAGGCATAAAGG + Intronic
1052084398 9:24246994-24247016 CAGCAAGTGCAAAGGCCCCAAGG + Intergenic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053108729 9:35438295-35438317 CAGCATAAGAACAGGAAGCAGGG + Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053334855 9:37258347-37258369 CAGGATGATCACAGTCAGCATGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053414810 9:37940602-37940624 CAGCCTGAGTCAGGGCAGCAGGG - Intronic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1053789508 9:41676811-41676833 CAGCATGGGCAAAGGTCCCAAGG - Intergenic
1054155633 9:61637941-61637963 CAGCATGGGCAAAGGTCCCAAGG + Intergenic
1054177848 9:61888502-61888524 CAGCATGGGCAAAGGTCCCAAGG - Intergenic
1054475402 9:65568951-65568973 CAGCATGGGCAAAGGTCCCAAGG + Intergenic
1054659683 9:67692322-67692344 CAGCATGGGCAAAGGTCCCAAGG + Intergenic
1054753396 9:68931666-68931688 CAGCATGTGCAAAGGCCTAAGGG + Intronic
1054962100 9:70980344-70980366 CAGCATGATCACAGTCAGAAGGG + Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056572594 9:87828699-87828721 CAGCAGTGGCAGAGGCAGCATGG - Intergenic
1056760601 9:89411974-89411996 CAGCAAGTGCCAAGGCTGCAAGG - Intronic
1057182843 9:93039167-93039189 CAGCATGTGCCAAGGCCCCAGGG - Intergenic
1057886668 9:98834846-98834868 CAGCATGAGCAAAGGCTTAAGGG - Intronic
1058009490 9:99960735-99960757 TAGAATGCTCAAAGGCAGCAGGG - Intronic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1058091857 9:100814185-100814207 CAGAGGGAGCCAAGGCAGCAGGG - Intergenic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1058637464 9:107050274-107050296 CAGCATGTGCAAAGGCACCAGGG - Intergenic
1058770118 9:108222848-108222870 CAGCATGTGCACAGGTGGCATGG - Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059349607 9:113655140-113655162 CAGCCTGTGCAAAGGCCCCAAGG - Intergenic
1059350758 9:113663218-113663240 CAGCTTGTGCAAAGGCAAAAAGG - Intergenic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1059419542 9:114182515-114182537 CAGCATGGGCAAACGCAACGAGG + Intronic
1059440510 9:114304227-114304249 CAGCATGTGCAAAGGCCCCATGG + Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059623063 9:116030088-116030110 CATCATATGCAAAGGCAGGAAGG - Intergenic
1060698192 9:125728214-125728236 CAGCACGGCCAAAGGCAGGAAGG + Intergenic
1060775741 9:126372891-126372913 CAACACGAGCAAAGGCAGGGAGG + Intronic
1061230006 9:129310135-129310157 GAGCATGTGCAAAGGCCCCAAGG - Intergenic
1061429720 9:130523482-130523504 CAGCATGTGCAAAGGCCAGAGGG + Intergenic
1062011711 9:134270748-134270770 CAGCCTGTGCAAAGGCCCCAAGG + Intergenic
1062306764 9:135911771-135911793 CAGCAGAAGAGAAGGCAGCAGGG + Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1185865622 X:3621366-3621388 CAACATCAGCAAACGCAGCATGG + Intronic
1186216508 X:7306804-7306826 CAGCATGACAAAAGAGAGCAAGG - Intronic
1186443205 X:9603832-9603854 CAGCAACACCAAAAGCAGCAAGG - Intronic
1187797579 X:23021174-23021196 CAGCATGACCAAAGTCAGAATGG + Intergenic
1189206349 X:39242480-39242502 CCGCATGAGCAAAGGTATGAAGG + Intergenic
1189225075 X:39406281-39406303 TAGCATGAGCAAAGGCCTGACGG - Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1189891745 X:45610267-45610289 CACCATCAGCACTGGCAGCATGG + Intergenic
1189926069 X:45956896-45956918 CAGCACGAGTAAAGGCATAAAGG + Intergenic
1190098208 X:47499764-47499786 CAGCATGGCCAAAAGCAGCCAGG - Intergenic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1191741786 X:64443934-64443956 CAGCATCAGAAAAGGCAGTGGGG + Intergenic
1191753333 X:64567370-64567392 CAGCATAAGCAAAGGCACAAAGG - Intergenic
1192033479 X:67539873-67539895 CAGAATATGCAAAGGCAGGAAGG + Intergenic
1192343013 X:70279804-70279826 CAGCATGGGCAAAGGCTAGAAGG + Intronic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1194012858 X:88583968-88583990 CAGGATCAATAAAGGCAGCAAGG + Intergenic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1194875251 X:99179008-99179030 AAGCATGAGGTAAAGCAGCAAGG - Intergenic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1196091130 X:111744693-111744715 CAGCATGAGGAATAGCAGAATGG - Exonic
1196294336 X:113981219-113981241 CAGAAAGGGCAAAGGCCGCAAGG + Intergenic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic
1196505230 X:116434498-116434520 TAGCATGAGCAAAGGCACTGAGG + Intergenic
1196755821 X:119156268-119156290 CAACATCAGCCAAGGGAGCAAGG + Intergenic
1196756997 X:119166727-119166749 CTGTATGTGCAAAGGCTGCATGG - Intergenic
1197779390 X:130144507-130144529 CAGCATAAGCAAAAGCACAAGGG - Intronic
1197812235 X:130455518-130455540 GAGCAGGAGCAAAGGGGGCAGGG - Intergenic
1197834167 X:130677061-130677083 CAGCATGAGCAAAAGTACAAAGG - Intronic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198475066 X:136988145-136988167 CATCATGAGCAAAGGCACGATGG - Intergenic
1198548936 X:137724437-137724459 TAGCATGGGCAAAGACAGAAAGG - Intergenic
1198775038 X:140170618-140170640 GAGCATGAACAAAGACAGGAGGG + Intergenic
1199137110 X:144266309-144266331 GAGCAGGAGCAGTGGCAGCATGG - Intergenic
1199856905 X:151766757-151766779 CTACATGAGCAAAGGCACAAAGG + Intergenic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1202132482 Y:21626007-21626029 CAGCAGTTGCAAAGGCAGAAAGG - Intergenic