ID: 1053368818

View in Genome Browser
Species Human (GRCh38)
Location 9:37543376-37543398
Sequence GGAGTTGCAATTCTAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053368816_1053368818 -6 Left 1053368816 9:37543359-37543381 CCTTTTCCAGGAGAACAGGAGTT 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1053368818 9:37543376-37543398 GGAGTTGCAATTCTAGAATCAGG No data
1053368813_1053368818 3 Left 1053368813 9:37543350-37543372 CCATCGAGCCCTTTTCCAGGAGA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1053368818 9:37543376-37543398 GGAGTTGCAATTCTAGAATCAGG No data
1053368815_1053368818 -5 Left 1053368815 9:37543358-37543380 CCCTTTTCCAGGAGAACAGGAGT 0: 1
1: 0
2: 2
3: 16
4: 250
Right 1053368818 9:37543376-37543398 GGAGTTGCAATTCTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053368818 Original CRISPR GGAGTTGCAATTCTAGAATC AGG Intronic
No off target data available for this crispr