ID: 1053369823

View in Genome Browser
Species Human (GRCh38)
Location 9:37551410-37551432
Sequence TAGATTTCAAAGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053369823 Original CRISPR TAGATTTCAAAGGATGCTGC AGG (reversed) Intronic
900872985 1:5318173-5318195 TAGATTCCAAAGGATGATCTGGG - Intergenic
902882566 1:19382430-19382452 CAGGTTTCAAACGGTGCTGCTGG + Intronic
903645324 1:24892170-24892192 TAGATTTCAGAGGATGTAACTGG - Intergenic
903860370 1:26360962-26360984 TACATTTCAGAGGATCCTCCGGG + Intergenic
907627068 1:56040592-56040614 TAGATTTCAAAGGATGCCCCCGG - Intergenic
908549320 1:65193166-65193188 TAGATTTCAATGAATGCCCCTGG - Intronic
909831945 1:80202848-80202870 TAGATTTCAAAGGATGACCCAGG - Intergenic
909908238 1:81225752-81225774 TGGATTTTAAAGGTTGGTGCGGG + Intergenic
910749567 1:90614205-90614227 TAGATTTCACAGTGTGCAGCAGG + Intergenic
911245557 1:95512526-95512548 TAGTTTGCCAAGTATGCTGCTGG + Intergenic
912114774 1:106392494-106392516 TAGATTATAAAAGATGCGGCCGG + Intergenic
915523244 1:156460777-156460799 TAGAGTTCAAGGGATGCAGAGGG + Intergenic
916397964 1:164412692-164412714 TAGATTTCAAAGGATGCCCCAGG + Intergenic
916886247 1:169071274-169071296 TAGATTTCAAAGAATACTCTAGG + Intergenic
917650281 1:177069556-177069578 AAGCTTTCTATGGATGCTGCTGG + Intronic
918637151 1:186791252-186791274 TAGTTTTCAACAGATGGTGCTGG + Intergenic
924735200 1:246749458-246749480 TACATTTCAAAGGATCCTATGGG + Intronic
1065779558 10:29154320-29154342 TAGAGTTCAAAGCATCCAGCTGG - Intergenic
1065822638 10:29540114-29540136 TACATTTCAAAGCATTATGCTGG - Intronic
1067162428 10:43838605-43838627 TAGATTTCAAAGGATGTCACAGG - Intergenic
1068805479 10:61190202-61190224 TACATTTCAATGGATACAGCAGG + Intergenic
1069850903 10:71404342-71404364 TAAATTTAAAAGGCAGCTGCAGG - Intronic
1071300398 10:84252169-84252191 TTCATATCAAAAGATGCTGCTGG + Intronic
1071580500 10:86765171-86765193 TAGATTTTAAAGCATTCTGATGG - Intronic
1074209281 10:111314329-111314351 TAGACTTCAAACTATACTGCAGG + Intergenic
1076035917 10:127197935-127197957 TGTATACCAAAGGATGCTGCGGG - Intronic
1084632585 11:70363812-70363834 TATATTTCAATGGATGCTTCTGG - Intronic
1086730558 11:90243565-90243587 GAGATTTCAAACTATGATGCAGG + Intergenic
1089663294 11:119999763-119999785 TAGATTGTAAAGGAGGATGCTGG + Intergenic
1091016428 11:132055100-132055122 CAGATTGCAAAGGATGGGGCTGG + Intronic
1091102352 11:132886769-132886791 TTCATTTCCAAAGATGCTGCAGG - Intronic
1093572508 12:20683191-20683213 TACATCTCAAAGGATGCTAAGGG + Exonic
1096805277 12:54137104-54137126 CAGTTTTAAAAGGAAGCTGCAGG - Intergenic
1097073848 12:56377402-56377424 TAGGTTTCACAGGATGCAGCAGG + Intergenic
1100247149 12:92770172-92770194 TAAATTTCAGAGGATTCTGCGGG - Exonic
1101371420 12:104134912-104134934 TAGATCTCAAAGGATAATGTAGG - Intronic
1101658744 12:106747605-106747627 TAACTTTCCAGGGATGCTGCTGG + Intronic
1104080750 12:125428669-125428691 TAGATTTAAAGGCATGGTGCAGG - Intronic
1104717405 12:131025311-131025333 TATATTTCTGAGGATGTTGCGGG + Intronic
1104848432 12:131858802-131858824 TAGACTTCACATGATGCTCCCGG + Intergenic
1107744391 13:43489439-43489461 TAGATTTCAAAGGATGTCTCAGG + Intronic
1109148204 13:58809464-58809486 CAGATTTCAAAGGCTTTTGCTGG + Intergenic
1110509403 13:76331196-76331218 TCGTTTTCAAAGAATGCTGGGGG + Intergenic
1112713143 13:102153156-102153178 TATATTTCAAGGGAGGCTGGAGG + Intronic
1113433953 13:110274582-110274604 TATATGTGAAAGGATGCGGCAGG + Intronic
1113777522 13:112956568-112956590 GAGTTTTCAGAGGATGCTGGAGG + Intronic
1115006561 14:28492383-28492405 GAGATTTCAAAGGATGCCTCAGG - Intergenic
1116869919 14:50061065-50061087 CAGATACCCAAGGATGCTGCAGG + Intergenic
1120829447 14:88985084-88985106 TACAGTGCAAAGGATGCTGTAGG + Intergenic
1124345694 15:28920054-28920076 TAGACTGCACATGATGCTGCTGG - Intronic
1125149555 15:36516408-36516430 TTGCTTCCAAAGGATGCTGAGGG - Intergenic
1126244147 15:46484174-46484196 TGGATTTTCAAGGATGCTGTGGG - Intergenic
1128227324 15:66011205-66011227 AAGATTTCAGAGGATCCTGAGGG + Intronic
1128496274 15:68200364-68200386 GAGACTTCAAAGGGTCCTGCTGG + Intronic
1129909136 15:79211721-79211743 TATAATCCAAAGGATGATGCAGG - Intergenic
1130310629 15:82750678-82750700 CAGGTTTCAGAGGATGCGGCTGG + Intergenic
1130554539 15:84913583-84913605 AAATTCTCAAAGGATGCTGCTGG + Intronic
1131956955 15:97747238-97747260 TAGAACTCAAAAGTTGCTGCTGG + Intergenic
1137630476 16:49939898-49939920 TTGCTTTTAAAGGATGCTACTGG + Intergenic
1138807231 16:60104807-60104829 TAAATTTCAAAGAATACAGCAGG - Intergenic
1139714850 16:68804699-68804721 TATAGTTCAAAGGATCCTTCTGG + Intronic
1140544888 16:75797978-75798000 TTGGTTTCCAAGGCTGCTGCTGG + Intergenic
1140928304 16:79602865-79602887 TAAATAGCAAAGCATGCTGCGGG - Intergenic
1143213022 17:5203508-5203530 TAGATTTCAAAGGATTCCTGGGG + Intergenic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1150832796 17:68539427-68539449 GGGAATGCAAAGGATGCTGCCGG - Intronic
1151820546 17:76494446-76494468 TGGATTTCAAAAGCTGCTGGTGG + Intronic
1156580425 18:38368634-38368656 TAGATTTCCATGACTGCTGCAGG + Intergenic
1157089746 18:44623677-44623699 TAGATTTTAAAGGAGGTTACAGG - Intergenic
1157109922 18:44810944-44810966 TAAATTTCAAAAGATTCTGAAGG + Intronic
1158014052 18:52763419-52763441 TGGGATTCAAAGGATGCTCCTGG - Intronic
1159574074 18:70155011-70155033 TAGATATCACAGGAAGTTGCAGG - Intronic
1159660300 18:71087905-71087927 TATATTTCAAAGGATAATTCCGG - Intergenic
1160434624 18:78837737-78837759 TAGATTTTAAAGGATGATGTAGG + Intergenic
1161472301 19:4464562-4464584 TAGTTTTTAAACGATACTGCAGG + Intergenic
1161745497 19:6057088-6057110 TGGATTCCAAAGGCTGGTGCCGG - Intronic
1161827714 19:6580079-6580101 TAAATTTCAAAAGATGAGGCTGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163512008 19:17741082-17741104 CAGATCCCAAAGGATGCTGTAGG - Intergenic
1165529508 19:36386360-36386382 TAGATTTCAAAGGATGCCTTGGG + Intronic
1165692819 19:37876815-37876837 TTGTTTTCAAAGGATCCTTCTGG + Intergenic
1167589066 19:50393032-50393054 GGGATTTCAAACGATGCTTCCGG + Intronic
1167873433 19:52392046-52392068 TAGATCTCACAGGAGGCTGAGGG + Intergenic
1167985493 19:53311220-53311242 GGGATTTCACAGGCTGCTGCTGG - Intergenic
1168699431 19:58427806-58427828 TAGATCTCATAAGATGGTGCTGG - Intergenic
926819327 2:16835305-16835327 TCTATCTCCAAGGATGCTGCAGG + Intergenic
929903942 2:46029809-46029831 TACATTTCAAAAAAAGCTGCAGG - Intronic
934695603 2:96397846-96397868 TAGATTGCAAAGGATGCCTCCGG - Intergenic
938804904 2:134796951-134796973 TAGATTTCTAAGGGTCCTCCTGG + Intergenic
938981436 2:136530890-136530912 CAGAGTTCCAAGGATGGTGCAGG + Intergenic
940654146 2:156468195-156468217 TATAGTTAAAAGGGTGCTGCTGG + Intronic
942921438 2:181378438-181378460 TAAATTGCACAGGATGGTGCAGG + Intergenic
944180141 2:196882253-196882275 TTGACTTCAAACTATGCTGCAGG - Intronic
945734325 2:213580065-213580087 TAGATTTTAAAGCTTGCTTCAGG - Intronic
946154446 2:217798037-217798059 CAGATTTCAAAGTATGATCCGGG + Intergenic
1169763754 20:9126710-9126732 TGCATTTCCAAGGCTGCTGCTGG - Intronic
1176662701 21:9654157-9654179 TACATTTCAAAGTATACTTCAGG - Intergenic
1177892416 21:26822500-26822522 TTCATTTCAAAGGATACTTCAGG - Intergenic
1178221604 21:30667139-30667161 AAGAATTCAAAGCATTCTGCTGG - Intergenic
1179654081 21:42834389-42834411 GAGATCTCAAAAGATGCTGTTGG + Intergenic
1184308141 22:43622933-43622955 TAGATTTCACTGAATGCAGCTGG + Intronic
951285773 3:20811436-20811458 AAGATTGCAAAGAAGGCTGCGGG - Intergenic
951888613 3:27549049-27549071 TAGATATAAAAGGATGCAGCTGG - Intergenic
952640839 3:35593607-35593629 TTGATTTCAAAAGTCGCTGCTGG - Intergenic
953665208 3:44920974-44920996 TGGATTTAAAGGGATCCTGCAGG + Intronic
955094647 3:55785291-55785313 GAGAAATCAAAGGATGGTGCTGG - Intronic
956073323 3:65478131-65478153 AAGATATAAGAGGATGCTGCTGG + Intronic
956748558 3:72328840-72328862 CAGTTTTCAAAGGTTGCTCCTGG + Intergenic
959593065 3:108100293-108100315 TGGTTCTCAAAGGATGCTACTGG + Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG + Intergenic
970608712 4:17706424-17706446 TAGATACCAAAGCATGCTGTGGG + Intronic
971169558 4:24219268-24219290 AAGAGTTCAAAGCACGCTGCTGG - Intergenic
972135029 4:35881870-35881892 TATATTTGAAAAAATGCTGCTGG - Intergenic
974794815 4:66734976-66734998 TAGATTTCAGAAGGTGCAGCAGG + Intergenic
974846478 4:67357175-67357197 TAGACTCCAAAGCATGGTGCTGG - Intergenic
974967270 4:68776453-68776475 TAGATTTAAAAAGATACTGAAGG - Intergenic
978035387 4:103986364-103986386 TACATTTCAAAGGATGCACTGGG - Intergenic
980581295 4:134755851-134755873 TAGATTTCAAATGTTCCTGTTGG - Intergenic
980660022 4:135845346-135845368 TAAATCTCAAAGGATTATGCTGG + Intergenic
981821716 4:148894735-148894757 TATATTTCATAAGATGCTGCAGG + Intergenic
985412635 4:189702024-189702046 TACATTTCAAAGTATACTTCAGG + Intergenic
986557947 5:9030258-9030280 AAGTTTTCAAAGGATGCATCAGG - Intergenic
988091778 5:26551489-26551511 TAGTTTTCAATAAATGCTGCTGG + Intergenic
988497925 5:31760493-31760515 TAGATTTCAAAGAATGGTATGGG + Intronic
989340474 5:40368483-40368505 TAGATTTCAATGGATGTCTCAGG - Intergenic
990398941 5:55417195-55417217 CAGAATTCAAAGGATGCTTTGGG - Intronic
990598397 5:57333436-57333458 AAGATTTCAAAGGACACTGAGGG + Intergenic
992257280 5:74933703-74933725 TAAAGTTCAAAGGATGCTGTTGG - Intergenic
995619854 5:114012874-114012896 TATATTTTAAAGGATGTTGTTGG - Intergenic
996218379 5:120896188-120896210 TATATTTCACAGGATCCTTCTGG - Intergenic
998426909 5:142036667-142036689 TAGATTTCAAAGGAGGCAGCTGG - Intergenic
1000514758 5:162226394-162226416 TAGATTTCAAAAGACCCTGAAGG - Intergenic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1002597365 5:180332909-180332931 AAGATTTCAAAAGATGCTGTGGG - Intronic
1004584347 6:16985159-16985181 TAACTCTCTAAGGATGCTGCTGG - Intergenic
1005513171 6:26530317-26530339 TTGTTTTCAAATGAGGCTGCAGG + Intergenic
1007938046 6:45751305-45751327 TAGATTTCAGAGGAAGTTGGGGG + Intergenic
1007979331 6:46134440-46134462 TTGAGTTAAAAGGATGCTCCAGG - Intronic
1009300039 6:62006815-62006837 TAGATATCAAAGGATGATGGTGG + Intronic
1009737338 6:67693323-67693345 TTGATTTAAAAGCATGCTTCAGG - Intergenic
1013407755 6:109858478-109858500 AACCTTTCAAAGCATGCTGCGGG + Intergenic
1014049028 6:116930174-116930196 TAGATTACAAAGTGTGCTGCAGG + Intronic
1016700717 6:147050901-147050923 CAGAGGACAAAGGATGCTGCTGG + Intergenic
1022215309 7:28254200-28254222 TTGATTACAAAGGAGGCTGGGGG - Intergenic
1022237524 7:28476287-28476309 AAGATTCCAAAGGATGTTGAAGG - Intronic
1023396932 7:39760053-39760075 TGCATTTCAAAGGATCCTGCGGG - Intergenic
1024947959 7:54830783-54830805 TAGATTTAAAAAGATGGTCCTGG - Intergenic
1026458292 7:70591746-70591768 TAGACTACAAAGTATGTTGCAGG - Intronic
1026670286 7:72384340-72384362 TTGATTTCAACAAATGCTGCTGG + Intronic
1028123144 7:87080023-87080045 TAGACTTCAATAGATGGTGCTGG + Intergenic
1030538860 7:110803791-110803813 TAGTTTTCAAAGTATGGTCCTGG + Intronic
1030735584 7:113043992-113044014 TAAAATTTAAAGGATGCTTCAGG - Intergenic
1031332372 7:120481849-120481871 TAGATTTCAAAGGATGTCACAGG + Intronic
1031417069 7:121507574-121507596 TAGATCTCAAAGGATCCTATAGG + Intergenic
1033046136 7:137963693-137963715 AAGATTTCAAAAGATCCTGGGGG - Intronic
1033927309 7:146479165-146479187 TAGTTTTGAATGGAGGCTGCAGG + Intronic
1038845410 8:31224621-31224643 TAGCTTTCAAAGCAAGCAGCTGG + Intergenic
1039172955 8:34769452-34769474 TAGAGATCAAAGGCTGATGCTGG - Intergenic
1040942271 8:52845549-52845571 AAGATTTTACAGCATGCTGCTGG + Intergenic
1042175660 8:66035189-66035211 TAGATTTCCAGGGATGGTGGGGG - Intronic
1043068538 8:75608323-75608345 CATATTTCAAATTATGCTGCTGG + Intergenic
1043552495 8:81390534-81390556 TAGAAGTCACATGATGCTGCTGG + Intergenic
1047162327 8:122394496-122394518 TAGATTTTAAAAAATGCTGCTGG - Intergenic
1047602235 8:126437408-126437430 TTGCTTTCAAAGCATCCTGCTGG - Intergenic
1050574981 9:6985474-6985496 GAGATTGCATAGGATGTTGCTGG + Intronic
1050662660 9:7899924-7899946 TAGATCCAAAAGGCTGCTGCTGG + Intergenic
1051708092 9:19901688-19901710 TAGATGTCAAAGGCTGAAGCTGG + Intergenic
1051810068 9:21038489-21038511 TAGATTACAAAAGATGTTGCAGG - Intergenic
1051968958 9:22863674-22863696 TAGGTTTCAAAGGATGCCCCAGG - Intergenic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1053506817 9:38650257-38650279 GAGAATTCAAAGGCTCCTGCAGG + Intergenic
1055965144 9:81858924-81858946 TCTATTTTAAAGGATGGTGCTGG - Intergenic
1056036184 9:82608527-82608549 AAGCTTCCAAAGGATGCTGTTGG + Intergenic
1057636092 9:96769058-96769080 TAGTTTTCAACAGATGATGCTGG + Intronic
1058271335 9:102975529-102975551 TACATTTCAAAGAATGCTGCAGG - Intergenic
1062136853 9:134933685-134933707 TATATTCCCAAGGTTGCTGCTGG - Intergenic
1203669956 Un_KI270755v1:959-981 TACATTTCAAAGTATACTTCAGG - Intergenic
1186203614 X:7178585-7178607 TAGAATTGAAAGGATTTTGCAGG - Intergenic
1187916206 X:24154487-24154509 CAGTTTTCAAAGTGTGCTGCAGG + Intronic
1189666224 X:43357669-43357691 TAGATTTCAAAGGATGCTTCTGG - Intergenic
1190063516 X:47225424-47225446 TCGATTTCACGCGATGCTGCAGG + Intronic
1190128477 X:47725564-47725586 TAGATGTCAAAGGATGAGGTGGG + Intergenic
1194252276 X:91590567-91590589 TAGACTTCAAACTATACTGCAGG + Intergenic
1196017947 X:110959428-110959450 TAGATCTCAAAGGATACAGACGG - Intronic
1198813042 X:140555444-140555466 TATCTTTAAAAGGATGGTGCTGG + Intergenic
1199160126 X:144599376-144599398 TAGATTTTAAAGAATGTAGCTGG - Intergenic
1199818453 X:151421117-151421139 TAGGTTCCAAAGGATGCTTTTGG + Intergenic
1200571204 Y:4831807-4831829 TAGACTTCAAACTATACTGCAGG + Intergenic