ID: 1053370166

View in Genome Browser
Species Human (GRCh38)
Location 9:37554168-37554190
Sequence ACAAGGGATCCATATGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053370166 Original CRISPR ACAAGGGATCCATATGGTGT TGG (reversed) Intronic
902030988 1:13422086-13422108 ACAAGGGTCCCATAAGCTGTTGG - Intergenic
906618381 1:47252083-47252105 ACAAAGGATACATATGGGCTGGG + Intronic
917489262 1:175483732-175483754 CCAAGGGAGCCAGATGGTGGGGG + Intronic
920931944 1:210396927-210396949 ACAAGGAATCCTTGTGGTGATGG + Intronic
924522906 1:244821011-244821033 AGAAAGCATCCATATGGTGAGGG - Intergenic
1065855742 10:29828575-29828597 GGAAGGGATCCAGATGGTGCTGG + Intergenic
1068833773 10:61528605-61528627 ACAAGGGATGCTTGTGGTGATGG + Intergenic
1071122279 10:82292873-82292895 AAGAGGGATCCTTATGGTGAAGG + Intronic
1072713241 10:97731934-97731956 GCAAGGGAGCCATCTGGTGGAGG + Intergenic
1075505698 10:123019802-123019824 ACAAGGGATCCTTATGCTGTTGG - Intronic
1075816301 10:125267086-125267108 ACAATGGATCCCTTTGGTCTGGG + Intergenic
1080021381 11:27563861-27563883 AAAAGAGATCCATATGCTTTGGG - Intergenic
1084707536 11:70824002-70824024 ACAAGGGACACATGTGGTGCTGG + Intronic
1084963310 11:72729179-72729201 ACAAGGGATTCTTAAGTTGTTGG + Intronic
1090075273 11:123576716-123576738 ACAAGGAAATAATATGGTGTGGG + Intronic
1090947711 11:131446646-131446668 ACATGGGATCCAAGTGCTGTGGG - Intronic
1097769534 12:63566403-63566425 ACAAGGGATCTCTGTGGTGATGG - Intronic
1098594092 12:72251245-72251267 ATAAGGGACCCTTATGGTGATGG - Intronic
1100228425 12:92582577-92582599 CCAAGGGATGCATCTGCTGTTGG - Intergenic
1102850856 12:116243606-116243628 ACAAGGGATCTAGTTGCTGTGGG - Intronic
1108107102 13:47022570-47022592 ACAATGGATCCCTCTGGTGATGG + Intergenic
1109051665 13:57491019-57491041 ACGAGGGATCCTTGTGGTGATGG - Intergenic
1110768458 13:79307281-79307303 AAGAGGGATCCTTATGGTGATGG - Intergenic
1111690357 13:91556026-91556048 ACCAGGGATCCTCATGGTGATGG - Intronic
1113725108 13:112592710-112592732 CCAAGGGACCCATGTGGTCTCGG + Intergenic
1114680142 14:24477452-24477474 ACAATGGCTCCATGTGGTGGAGG + Intergenic
1119311968 14:73654966-73654988 ACAAAGGATCCTTTTGGTATTGG + Intronic
1120966837 14:90175036-90175058 ACAGTGGATCCATTTGGTGGGGG + Intronic
1121172219 14:91864084-91864106 CCAGGGGATCCATTTGGTGGGGG + Intronic
1121266706 14:92608047-92608069 ACAAGGGAGCTCTGTGGTGTTGG + Intronic
1121953546 14:98193740-98193762 ACAAGGGATCCATTCGTTGAAGG + Intergenic
1122537314 14:102474736-102474758 ACAAGGGACCCATCTTTTGTGGG + Intronic
1124608583 15:31192146-31192168 AAAAGGGATCCTTATGGGGATGG + Intergenic
1125603383 15:40927520-40927542 TCCAGGGATCCATAGGGTATAGG + Intergenic
1128985521 15:72217909-72217931 AAAAAGAATCCATATGGTTTAGG - Intronic
1138517975 16:57548561-57548583 ACAAGGGATCCTTGTGGCGATGG - Intronic
1147523398 17:41196636-41196658 ACAAGGGATCCTTGTGCTGATGG - Intronic
1156614709 18:38769625-38769647 ACAAGGGATTGATCTGATGTGGG - Intergenic
1157170236 18:45397278-45397300 AAAGGGAATACATATGGTGTTGG - Intronic
1159341372 18:67137863-67137885 ATAAAGATTCCATATGGTGTAGG + Intergenic
1165331751 19:35144170-35144192 AGAAGGGAGCCATGTGGGGTGGG + Intronic
1166833680 19:45653769-45653791 CCATGGGCTCCATATGGTGCGGG + Intergenic
925524271 2:4782455-4782477 ACAATGGATTCATAGGATGTTGG - Intergenic
926637267 2:15195480-15195502 AAAAGGGATCCTTGTGTTGTTGG + Intronic
929870954 2:45758946-45758968 ACAAGGGAGTGATATGGTGAAGG + Intronic
932221660 2:70004210-70004232 ACAAGGACTCCATCTGGAGTTGG - Intergenic
933641182 2:84762028-84762050 ACAAAGGCTCCATATGGGTTGGG + Intronic
935260070 2:101346929-101346951 ACAAGAGATCCTTGTGGTGATGG - Exonic
935942808 2:108258974-108258996 ACATGAGATCCACAAGGTGTTGG + Intronic
936850386 2:116889854-116889876 ACAAGATATCCATATGCTGATGG - Intergenic
940175422 2:150872500-150872522 CCAGTGGATCCATATGGTGGAGG + Intergenic
943094184 2:183408932-183408954 ATAAGGGATTCCTATGGTGATGG - Intergenic
944358320 2:198820519-198820541 ATAAGGGATACATATGTGGTAGG - Intergenic
945006390 2:205411891-205411913 AGAAGGGACACAAATGGTGTGGG + Intronic
949014319 2:241701350-241701372 CCAAGGCATCCAGATGGTGCGGG + Intergenic
1169389760 20:5180240-5180262 AAGAGGGATCCACATGGTATAGG - Intronic
1170758257 20:19224227-19224249 ATAAGGGATCCTTGTGGTGTTGG - Intronic
1174113999 20:48214574-48214596 GCAAGGGAGCCCTGTGGTGTGGG - Intergenic
1174167847 20:48597955-48597977 GCAAGGGAGCCTTGTGGTGTGGG + Intergenic
1174706428 20:52660810-52660832 ACAAAAGAACCATATTGTGTTGG - Intergenic
1181104217 22:20563543-20563565 ACGAGGGATCCTTGTGGTGTGGG + Intronic
1181116860 22:20636793-20636815 ACAAGGGAGCGATGTGGTGTAGG + Intergenic
950100986 3:10356667-10356689 ACAGGGGAGCCACAGGGTGTAGG + Intronic
953798555 3:46003850-46003872 ACAGGTCATCCATATGCTGTAGG - Intergenic
954100728 3:48370539-48370561 AAGAGGGATCCATAAGGAGTTGG - Intergenic
955722338 3:61896161-61896183 ATGAGGGATCCTTATGGTATTGG - Intronic
958509520 3:95028644-95028666 ACAAGTGTTCCAGATAGTGTAGG - Intergenic
962068748 3:132011208-132011230 ACAAGGGATCTATCTACTGTGGG - Intronic
962884225 3:139608838-139608860 ACAAGGGTTCCTTATAGTGATGG - Intronic
964415497 3:156443616-156443638 ACAATGGATCTACATGGTGGAGG + Intronic
965951483 3:174313433-174313455 ACCAGGCATCCATCTGGAGTAGG - Intergenic
966529325 3:180957001-180957023 ACATCGGTTCCATATGGTGAAGG + Intronic
970212387 4:13723280-13723302 ACAAGGAATCCTTATGGTGATGG - Intergenic
971821238 4:31558024-31558046 ACAAGGAAAACATATGGTTTAGG - Intergenic
974698793 4:65410460-65410482 ACAAGGGATCTTTACGGTATTGG + Intronic
976046441 4:80953955-80953977 AAAAGGGACCCATATGGCCTAGG + Intronic
977394995 4:96459661-96459683 AGAAGGGATCCTTGTGGTTTTGG + Intergenic
977623725 4:99166442-99166464 ACAAGGCATCCATATACTGAGGG + Intergenic
978712403 4:111800209-111800231 TCATGGGATCCATATGGAGTTGG + Intergenic
979929326 4:126611117-126611139 ACAAGGCATCCGTAGGGGGTGGG - Intergenic
982054677 4:151536394-151536416 AGAAGGGACCCACATAGTGTTGG - Intronic
988356457 5:30182675-30182697 ACCAGAGATCCATATGGTGGAGG - Intergenic
990180124 5:53151635-53151657 AGAAGGGGTCAAAATGGTGTAGG + Intergenic
990318460 5:54606917-54606939 ATAAGGGATCCTTGTGATGTTGG - Intergenic
995696920 5:114889215-114889237 ACAAGGGATTAATAAGGTTTTGG - Intergenic
997840029 5:137231017-137231039 ACCAGGGATCCTTGTGGTGATGG - Intronic
1001892824 5:175353332-175353354 ACATGGGATCCATCTGATGAGGG + Intergenic
1002990731 6:2235887-2235909 ACAAGGCAAACAAATGGTGTTGG + Intronic
1004432812 6:15561479-15561501 AGAAAGCATCCATATGGTGAGGG - Intronic
1006723447 6:36176935-36176957 ACAAGAGATCCTTGTGGTGATGG + Intergenic
1007296955 6:40830836-40830858 ACAAGGGAGCCTCATGGTGCTGG + Intergenic
1008755229 6:54787146-54787168 ACAAGGGATCTTTGTGGTGTTGG + Intergenic
1010488539 6:76446631-76446653 ACAAGGGATCTTTCTGGTGATGG + Intergenic
1012606454 6:101163778-101163800 AGAAAGGAGCCATCTGGTGTGGG + Intergenic
1016409145 6:143763636-143763658 AAAAGGAATCCCTATGGTTTTGG - Intronic
1016792444 6:148079649-148079671 ACGAGGGACCCAAATGGGGTAGG + Intergenic
1016823715 6:148368928-148368950 TCAAGGCATTCATATGATGTGGG + Intronic
1022059331 7:26775635-26775657 AGGAGGGATCCTTGTGGTGTTGG - Intronic
1022277597 7:28871019-28871041 ACAAGGGATTCCTGTGGTATTGG - Intergenic
1022367371 7:29736398-29736420 ACAAGGGATCTCTGTGGTGATGG + Intergenic
1022928814 7:35087502-35087524 ACAAGGGATCTCTGTGGTGATGG - Intergenic
1023963242 7:44945235-44945257 ACGAGGGATCTTTATGGTGAGGG + Intergenic
1028794551 7:94888512-94888534 ACAAGGGCTCCTTATGGACTAGG + Intergenic
1029824923 7:103181177-103181199 ACAAGGGATCTCTATGGTGATGG - Intergenic
1031353915 7:120767088-120767110 CCAATGGATCCATTTAGTGTGGG - Intergenic
1032412273 7:131704868-131704890 ACAGGAATTCCATATGGTGTGGG - Intergenic
1032573672 7:133029010-133029032 TGAAGGGCTGCATATGGTGTGGG - Intronic
1035423761 7:158753098-158753120 ACAAGGGATCAAGAGGGTGGGGG - Intronic
1037615502 8:20515339-20515361 ACTAAGTATCCATATGGTTTTGG + Intergenic
1039219526 8:35313704-35313726 ACATGGGAGCTATGTGGTGTTGG + Intronic
1041557889 8:59179464-59179486 ACAAGGAATCCTTGTGGTGAAGG - Intergenic
1042394045 8:68270621-68270643 ACAAGGAACCCATATGGTTCTGG + Intergenic
1042945913 8:74154320-74154342 ACATGGTCTCCAGATGGTGTAGG - Intergenic
1043026612 8:75078610-75078632 AGAGGAGATACATATGGTGTAGG + Intergenic
1044374326 8:91451516-91451538 TCAATGGTTCCATATGTTGTAGG + Intergenic
1045045704 8:98275218-98275240 ACAAGGGAGTCTTATGGTGATGG - Intronic
1045183324 8:99810482-99810504 ACCAAGAATGCATATGGTGTGGG - Intronic
1047167090 8:122451493-122451515 ACAATGGATCTATATTGTTTAGG - Intergenic
1053370166 9:37554168-37554190 ACAAGGGATCCATATGGTGTTGG - Intronic
1054936391 9:70693429-70693451 ATAAGAAATCCATATGGTGTTGG - Intronic
1061636986 9:131917775-131917797 GCAAGGGATCCAAAGGGTGTAGG + Intronic
1186080944 X:5931092-5931114 ACAATGGATCTATATAGTGATGG + Intronic
1186983505 X:14984993-14985015 ACAAGGGATAAATGTGGTGATGG + Intergenic
1188453203 X:30331366-30331388 ACAAGAGATGCCTATAGTGTAGG + Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1192141660 X:68651641-68651663 TGAAGGGCTCCATATGGTGGGGG - Intronic
1192270739 X:69577047-69577069 ACAAGGGATTCTTGTGGTGTTGG - Intergenic
1192283905 X:69713458-69713480 ACAAGGGATCCTTTTGATGTTGG - Intronic
1198807692 X:140506458-140506480 ATAAGGTGTCCATACGGTGTGGG + Intergenic
1200705292 Y:6437371-6437393 ACAGGTGATTCATATGTTGTGGG - Intergenic
1201028819 Y:9727337-9727359 ACAGGTGATTCATATGTTGTGGG + Intergenic