ID: 1053375212

View in Genome Browser
Species Human (GRCh38)
Location 9:37600374-37600396
Sequence CAGAATAAATAGGAGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053375212_1053375219 -3 Left 1053375212 9:37600374-37600396 CCGGCCACCTCCTATTTATTCTG 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1053375219 9:37600394-37600416 CTGCAGCCTAAGGACAGGTTGGG No data
1053375212_1053375221 4 Left 1053375212 9:37600374-37600396 CCGGCCACCTCCTATTTATTCTG 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1053375221 9:37600401-37600423 CTAAGGACAGGTTGGGCTTTTGG No data
1053375212_1053375217 -8 Left 1053375212 9:37600374-37600396 CCGGCCACCTCCTATTTATTCTG 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1053375217 9:37600389-37600411 TTATTCTGCAGCCTAAGGACAGG No data
1053375212_1053375218 -4 Left 1053375212 9:37600374-37600396 CCGGCCACCTCCTATTTATTCTG 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1053375218 9:37600393-37600415 TCTGCAGCCTAAGGACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053375212 Original CRISPR CAGAATAAATAGGAGGTGGC CGG (reversed) Intronic
900763876 1:4490974-4490996 CAGAAGAAAAAGGAGGTGACAGG - Intergenic
903116607 1:21183497-21183519 GAGAAAAAAAAGGAGGTGGCGGG + Intergenic
903516482 1:23914389-23914411 TAAAATAAACAGGAAGTGGCTGG - Intergenic
904391050 1:30186365-30186387 ATGAATAAATAGGGGGTGGATGG - Intergenic
907344985 1:53769240-53769262 AGGAGTAAATGGGAGGTGGCAGG + Intronic
908022529 1:59913195-59913217 CAAAATATATAGGAAGTTGCTGG - Intronic
910501033 1:87890876-87890898 AAGAATATATAGAAGCTGGCTGG + Intergenic
910693835 1:89991695-89991717 CAGAATGGATTGGAGGTGGGAGG + Intergenic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
913092430 1:115486641-115486663 CATATTAATTAGGAGGGGGCAGG + Intergenic
914419736 1:147518397-147518419 AAGTATAACTAGGAGCTGGCTGG - Intergenic
917740112 1:177953574-177953596 CAGGATCAAATGGAGGTGGCGGG - Intronic
918016932 1:180644180-180644202 CATAATTACTAGAAGGTGGCTGG + Intronic
918164389 1:181930649-181930671 CAGCATTAATAGGCAGTGGCAGG - Intergenic
920739437 1:208566489-208566511 CATAATAAATTGGAGGTGCCAGG + Intergenic
922289292 1:224197305-224197327 CAGGAGAATTAGGATGTGGCTGG + Intergenic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1064963863 10:20995584-20995606 CAAGATAAATAGGAGGACGCTGG + Intronic
1065211801 10:23411033-23411055 TAGAATACATAGTAAGTGGCAGG - Intergenic
1065947001 10:30614004-30614026 TAGAAAAAATAATAGGTGGCGGG - Intronic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1070681067 10:78449430-78449452 CAGAATGCATAGGATGTGGATGG + Intergenic
1071702851 10:87960307-87960329 CAGAATAAATATGAGGGGGTAGG - Intronic
1071922012 10:90361032-90361054 AACAAGAAAGAGGAGGTGGCAGG - Intergenic
1072139386 10:92576008-92576030 CTCAATAAAGAGGAGGTGGATGG + Intergenic
1072769915 10:98129229-98129251 CAGAATAAATAAGAAATTGCTGG - Intergenic
1072918323 10:99554294-99554316 AAGAAGGAGTAGGAGGTGGCTGG - Intergenic
1072982655 10:100112639-100112661 CTGAATAAATAGGAGTAGGGTGG + Intergenic
1073337635 10:102722057-102722079 GAGAATAAACAGGATGTGGATGG - Intronic
1073442622 10:103561557-103561579 TAGAATACAGAGGAAGTGGCTGG - Intronic
1073895140 10:108146753-108146775 GAGAATAAAAAGGAGGTGATGGG + Intergenic
1074512885 10:114134173-114134195 CAGAAAAAATGGGAGCTGTCAGG - Intronic
1075355092 10:121764908-121764930 GAGAATAAATATGAAGTGTCTGG + Intronic
1076656119 10:132024790-132024812 GAGAAGAAATAGGAGGGGGTGGG - Intergenic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1080479216 11:32628399-32628421 CAGATTAAATAGCAGATGCCTGG - Intronic
1081061671 11:38486332-38486354 CAGAATAAAAAGCAGGGAGCTGG + Intergenic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1085078709 11:73615559-73615581 TATAATAAATAGGTGGTGGCTGG + Intergenic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1087872515 11:103314160-103314182 CAGAATAGAAAGTGGGTGGCAGG - Intronic
1088693667 11:112348592-112348614 CAGAACCAATAGGATGTGGATGG - Intergenic
1088731198 11:112684568-112684590 AAGAAAACATAGGAGGTGGCTGG - Intergenic
1088750658 11:112839642-112839664 CAGTGTACACAGGAGGTGGCAGG + Intergenic
1090014277 11:123072006-123072028 GAGAATAAGTAGTGGGTGGCAGG - Exonic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1090845456 11:130526377-130526399 AAGAATAAAAAGGTGGTTGCCGG - Intergenic
1090911301 11:131121929-131121951 CAGAATAACAGGGAGGTGGAAGG + Intergenic
1091134656 11:133177941-133177963 CTGAATAAATGAGAGCTGGCAGG + Intronic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1092141482 12:6186663-6186685 CAGGATGAATAGGAGTTTGCTGG + Intergenic
1092305702 12:7298554-7298576 CAGAATAAATACAAGCTTGCTGG - Intergenic
1092889206 12:12953128-12953150 AGGAGTAAATTGGAGGTGGCGGG - Intergenic
1095851406 12:46811381-46811403 AAGAACAAATAGAAGTTGGCAGG + Intronic
1096256050 12:50063080-50063102 CAGGAAGAAAAGGAGGTGGCCGG - Intronic
1097389805 12:58996254-58996276 CATAATAAATATGATGTGGCAGG - Intergenic
1099288837 12:80749624-80749646 CAGAACAGATGGGAGTTGGCTGG + Intergenic
1099560266 12:84164501-84164523 CAGAATAAATAGGATATGTGCGG - Intergenic
1100237086 12:92672061-92672083 GAAAAAAAAGAGGAGGTGGCCGG - Intergenic
1101050673 12:100860441-100860463 CAGATAAAATAGGAGCTGGCAGG - Intronic
1101767736 12:107718263-107718285 CAGAAGAAATAAGAGGTGGTAGG - Intergenic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1104806492 12:131592556-131592578 CAGAAGAAAAAGGGGTTGGCTGG - Intergenic
1105464473 13:20625043-20625065 CAGAAGAGATAGGGGGTGGTGGG - Intronic
1106080849 13:26499283-26499305 AAGAAAAACTAGGAGCTGGCAGG + Intergenic
1107596653 13:41970160-41970182 GAGAAGAAATAGGAAGTGGTAGG + Intergenic
1108962744 13:56256400-56256422 CAGAAGATAAAGTAGGTGGCAGG - Intergenic
1111647727 13:91051732-91051754 TAGAGGAAATAGGACGTGGCTGG - Intergenic
1114532306 14:23403613-23403635 CAGACAAAACAGGAGATGGCAGG + Intronic
1119324083 14:73748618-73748640 CAGACAAAATATGTGGTGGCAGG + Intronic
1119922230 14:78457045-78457067 GAGGAGAAAGAGGAGGTGGCGGG - Intronic
1120440438 14:84530423-84530445 AAGAATAAATAGAAGCTAGCAGG + Intergenic
1121079771 14:91098151-91098173 GAAAATAATTAGGAAGTGGCTGG + Intronic
1121556546 14:94842110-94842132 TAGAACCAATAGGAGGTGGATGG - Intergenic
1124873459 15:33566860-33566882 CAGTATCAAAAGGAGGTGGGTGG - Intronic
1124876356 15:33598755-33598777 AAAAAAAAATAGGAGTTGGCTGG + Intronic
1125215629 15:37270323-37270345 CAAAATAACTAGCAGATGGCAGG - Intergenic
1125347123 15:38729503-38729525 CAGAACCAATAGGAGGTGTGTGG + Intergenic
1126437314 15:48648439-48648461 ATGAATAAAGAGGAGGTTGCCGG - Intergenic
1127301819 15:57662583-57662605 CAGAATGTATAGAAGGTGCCTGG + Intronic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1132587368 16:711462-711484 CAGACTAAGTGGGGGGTGGCTGG - Intronic
1133571321 16:7043124-7043146 CTGAGTAAATAGGAGTTGGGCGG - Intronic
1135720685 16:24815234-24815256 CAGGTTCAATAGGAGATGGCTGG + Exonic
1136998932 16:35211689-35211711 GAGAAGAAACAGGAGGTGTCGGG + Intergenic
1137029665 16:35510042-35510064 GAGAACAAACAGGAGGTGTCGGG - Intergenic
1137235348 16:46612404-46612426 TACAATAATTAGGAGATGGCTGG - Intronic
1138317576 16:56083437-56083459 AACAATAAATAGGAGGCTGCTGG - Intergenic
1138953655 16:61944643-61944665 CACAATAAATAGGAGCAGGCGGG + Intronic
1139180173 16:64737839-64737861 CAGAAAGCATAGGAGGTGCCAGG - Intergenic
1139928215 16:70503888-70503910 AAGAGTAAGTAGGAGTTGGCCGG - Intronic
1140016108 16:71187304-71187326 CAGAATAAATACAAGGTTACAGG + Intronic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1140033653 16:71357495-71357517 GAGAATGAAAAGGAGGTCGCTGG - Intergenic
1140263531 16:73400948-73400970 CAGAATTACTCGGAGGTGACGGG - Intergenic
1140869712 16:79095413-79095435 CAAAATAAATGGCAGGTGGAAGG + Intronic
1144406662 17:14958618-14958640 CAGAATAAATAGGGGGATGTAGG - Intergenic
1146447864 17:32947138-32947160 GAGAACCAATAGGAGGAGGCTGG + Intergenic
1146525712 17:33565368-33565390 CATAATAGTTAGTAGGTGGCAGG + Intronic
1147145786 17:38483803-38483825 AGGAATGAATAGGAGGGGGCAGG + Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147976128 17:44249156-44249178 TAGAAAAGAGAGGAGGTGGCTGG - Exonic
1148252214 17:46093213-46093235 AAGAATAACTAGGAGGTGACTGG - Intronic
1148368913 17:47079448-47079470 AAGAATAACTAGGAGGTGACTGG - Intergenic
1148555600 17:48577120-48577142 CAGAAGGAAGAAGAGGTGGCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148824537 17:50382779-50382801 GAGGAGAAATGGGAGGTGGCGGG - Exonic
1149370536 17:55989813-55989835 CAAAATGCTTAGGAGGTGGCAGG - Intergenic
1150056740 17:62023741-62023763 TAGAATATATAGGAGGTTGGGGG - Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150889892 17:69135653-69135675 CAGAATGAATAGCAGGTGTGAGG - Intronic
1151018256 17:70582654-70582676 AAGAAAAAATAGGAGGAGGAAGG - Intergenic
1151218073 17:72591585-72591607 CTGAATAGGTGGGAGGTGGCAGG - Intergenic
1154044268 18:10889726-10889748 CAGACTAACAAGGAGGTGTCAGG + Intronic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1156370357 18:36467243-36467265 CAGAATTACTAGGAGGTGACTGG - Intronic
1159359992 18:67387897-67387919 CAGTGTCACTAGGAGGTGGCAGG - Intergenic
1160254970 18:77240449-77240471 CAAAATAACTAGAAGGGGGCTGG - Intergenic
1161116164 19:2497691-2497713 AATAATAAATAAGAGGTGGTGGG - Intergenic
1162461915 19:10818446-10818468 GAGATGAAATGGGAGGTGGCGGG + Intronic
1162701530 19:12518818-12518840 AAGAAAAAAAAGGAGTTGGCTGG + Intronic
1163247053 19:16102845-16102867 CTGAATAAATAGGAGTAGGGTGG - Intronic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165903656 19:39180401-39180423 CAGAATAAATAAAAGGTTTCAGG + Intronic
1167372066 19:49088793-49088815 CACATTAAATAGGAACTGGCTGG - Intronic
927692960 2:25221344-25221366 CAGAATAAGCTGGTGGTGGCCGG + Intergenic
929789396 2:45012374-45012396 CAGAATACTTGGGAGGTGTCTGG + Intergenic
930296048 2:49555299-49555321 CAGAATAAAGAGTAAGTGGCAGG - Intergenic
931037540 2:58260261-58260283 CAGAAAAAAAAGGGGGTGGGTGG + Intergenic
932724589 2:74168275-74168297 CAGAATAAAATGGAAGAGGCAGG + Intronic
932736954 2:74260968-74260990 CAAAACAAATAGGAGGTTGGGGG - Intronic
933281085 2:80333604-80333626 AAGAAAAAAAAGGTGGTGGCTGG - Intronic
933651329 2:84852513-84852535 CAGAATGACCATGAGGTGGCAGG + Intronic
933900899 2:86849360-86849382 GAGAACAAATAGGAGGTGAGAGG - Intronic
934862747 2:97778152-97778174 CATAATAAATATGAAATGGCTGG + Intronic
934875905 2:97919962-97919984 CAGAGTACATAGGTGGAGGCTGG - Intronic
935779643 2:106499871-106499893 GAGAACAAATAGGAGGTGAGAGG + Intergenic
938910618 2:135882344-135882366 CAGAACTAATAGGAGGGGGGGGG - Intergenic
939675337 2:145065433-145065455 CAGAATAAATACCAGGAGACTGG + Intergenic
948549459 2:238760116-238760138 CAGAAAGAATAGGAGGTGAAGGG + Intergenic
1169804368 20:9544206-9544228 CAGAGTAGATAGGCTGTGGCAGG - Intronic
1171567286 20:26207798-26207820 AAGGATAAATAGGAGTTTGCTGG - Intergenic
1172939121 20:38642656-38642678 GAGAATAAATGGGTGGTGGAAGG - Intronic
1174380138 20:50150990-50151012 CAGAAAAAAATGGAGCTGGCCGG - Intronic
1179433235 21:41340000-41340022 GAGAATCAATAGGAGATGGGAGG + Intronic
1181996652 22:26888151-26888173 CTGAATAAAAAGAAGCTGGCTGG + Intergenic
1182735753 22:32531367-32531389 CAGAATAAAATGGGGTTGGCAGG - Intronic
1182765998 22:32759126-32759148 CAGAAGCAAGAGGAGGTGGAAGG + Intronic
1183670863 22:39271776-39271798 AAAAAAAAATAGAAGGTGGCTGG - Intergenic
1184506233 22:44905217-44905239 AAGAAAAAATAGGAGCAGGCAGG - Intronic
951898689 3:27635264-27635286 CTGAATAAATAGGAGTGGGGTGG - Intergenic
953915290 3:46915783-46915805 CAAAAGAAAGTGGAGGTGGCAGG - Intergenic
953994788 3:47511632-47511654 CAGAATATAAAGTAGTTGGCAGG - Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954073831 3:48162392-48162414 TACAAAAAATAGGAGGTGGGAGG - Intronic
955480891 3:59388670-59388692 CAGAATAAAGAGGAAGTGACAGG - Intergenic
956585906 3:70864398-70864420 CTGAATAAATTGAAAGTGGCTGG + Intergenic
957111062 3:75958516-75958538 AAGGATAAATAGGAGTTTGCTGG + Intronic
958832676 3:99108565-99108587 CAGATTAAGTTGGAGGTGTCAGG - Intergenic
958934165 3:100239491-100239513 CATAATAATTAGTAGCTGGCAGG + Intergenic
959352830 3:105289280-105289302 CAAAATAAATGCCAGGTGGCTGG + Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
960002025 3:112742565-112742587 CAGAATGAATAAGAGCTGCCTGG + Intergenic
961213828 3:125144620-125144642 CAGAAGGAATAAGTGGTGGCTGG - Intronic
961866528 3:129957304-129957326 GAGAATAGATTGGAGGTGGGGGG + Intergenic
963123903 3:141797835-141797857 CAGATTTAATGGGAGGTGGAGGG + Intronic
963445126 3:145395641-145395663 CAGAATAATACGGAGTTGGCTGG + Intergenic
963896707 3:150694107-150694129 AAGAAAAAATAGGAGGAGGAAGG - Intronic
964200559 3:154114334-154114356 TAGAATAATTTGGATGTGGCCGG - Intergenic
964553259 3:157908689-157908711 CAGGAAAAATTGGAGGTGGAGGG + Intergenic
968261160 3:197325230-197325252 CAGAAAAAATAGCACATGGCCGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968785641 4:2620550-2620572 AAGAATAATTAGCAAGTGGCAGG + Intronic
969504521 4:7576557-7576579 AGGAATGAATAGGAGTTGGCTGG + Intronic
970911010 4:21275648-21275670 AACAATAAATAGTAGATGGCTGG + Intronic
973334025 4:48937772-48937794 CAAAAAAACTAAGAGGTGGCCGG - Intergenic
974021803 4:56698219-56698241 AAGAAGAAAGAGGAGATGGCTGG + Intergenic
974983951 4:68995417-68995439 AAGAAGAAATAAGAGGTGGGTGG + Intergenic
974993799 4:69127972-69127994 AAGAAGAAATAAGAGGTGGATGG - Intronic
975791222 4:77953971-77953993 CAGAAGATATAGGAGATGGCGGG + Intergenic
978932773 4:114336421-114336443 TAGAATAAATGGGGGTTGGCTGG - Intergenic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981006209 4:139878212-139878234 AAGAATGAGTAGGAGTTGGCGGG - Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
982571943 4:157061522-157061544 CAAAATAATTAGGAGTTCGCTGG - Intergenic
983481216 4:168276933-168276955 CAGAAACAATAGGAGGTTGCTGG + Intronic
984348489 4:178561769-178561791 CACAATTAATATCAGGTGGCGGG - Intergenic
985877684 5:2612804-2612826 CAGAACACAGAGGAGCTGGCTGG + Intergenic
987608802 5:20175343-20175365 CAGGAAAAATAGGAGGCAGCAGG - Intronic
990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG + Exonic
992968862 5:82034548-82034570 CAGACTAAATAGGAAGTCACCGG - Intronic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997255010 5:132421834-132421856 CATAAGGAATAGGAAGTGGCCGG + Intronic
998672961 5:144374501-144374523 CAGGCTAAATGGGAGGTAGCAGG + Intronic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1000681858 5:164194937-164194959 CAGAATAAATAGGGGGAAACTGG - Intergenic
1001180318 5:169514096-169514118 CAGAATAAGTTGGGAGTGGCTGG + Intergenic
1003025424 6:2550913-2550935 CAAAAGAATTAGGAGGGGGCAGG + Intergenic
1006418683 6:33920195-33920217 CAGCATAACTAGGCGGTGGCTGG - Intergenic
1007044843 6:38762576-38762598 CAGAATAAATGGAGGGTGGGGGG + Intronic
1007267895 6:40611027-40611049 GAGAGTAATTAGGAGGGGGCCGG - Intergenic
1008187823 6:48416199-48416221 CTGAATAAATATGTGGTGCCAGG - Intergenic
1011735463 6:90305983-90306005 CAGAATGAGTAGGAGTTTGCTGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016100183 6:140090384-140090406 CAGAAATAATTGGAGGTGGCCGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017848049 6:158276701-158276723 CAGAATAATTGGGAAGTGGTGGG + Intronic
1018290960 6:162292258-162292280 CAGAATAACTTGGAAGAGGCCGG - Intronic
1018569464 6:165193894-165193916 CTGTATAAATAGGAAATGGCAGG - Intergenic
1019775049 7:2907333-2907355 AAAAATAAAAAGGATGTGGCCGG - Intronic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1020137628 7:5595583-5595605 AAGGATGAATAGAAGGTGGCAGG + Intronic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1021612080 7:22467303-22467325 CAGACTAATTGGGAGCTGGCAGG - Intronic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1022319314 7:29273774-29273796 CTGAATTAATGGGAGGTGGTTGG + Intronic
1022648956 7:32257578-32257600 CAGAATAATTACAAGGTGCCAGG - Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1025767409 7:64468345-64468367 TAAAATAAAAAGGAGGTGGGGGG + Intergenic
1027222496 7:76223007-76223029 AAGCATAAGTAGGAGTTGGCGGG - Intronic
1027632072 7:80619402-80619424 CTTAAGAAATAGGAGGTGGGTGG + Intronic
1027705766 7:81531675-81531697 CAGAACCAATAGGAGATGGGTGG + Intergenic
1028043076 7:86081762-86081784 CAGACTAAATAGGCTTTGGCAGG - Intergenic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1028152597 7:87391312-87391334 GAGCATAAATAGCAGGAGGCAGG + Intronic
1031006479 7:116478762-116478784 TAAATTAAATAGGAAGTGGCTGG - Intronic
1032361350 7:131258242-131258264 GACAATAAATAGGAGATTGCAGG - Intronic
1034982318 7:155487092-155487114 CAGAATAAATAGCAGGCGTTGGG - Intronic
1036631005 8:10515130-10515152 TAAAATAAAAAGGAGCTGGCAGG + Intergenic
1037027192 8:14053582-14053604 AACAATAAATAGGAGTTAGCCGG + Intergenic
1037136513 8:15469047-15469069 CAGAATAAAAACGAGAAGGCTGG + Intronic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1037794038 8:21976597-21976619 CAGAATACACAGGAGTTGCCAGG - Intronic
1041775168 8:61515063-61515085 GAGAAAAAATAGGAGGTAGGAGG + Intronic
1042466138 8:69131853-69131875 CTGAATAAATAGGAGTGGGGTGG - Intergenic
1043877998 8:85508546-85508568 CAGAACAAATAGGATGTGTTTGG + Intergenic
1044555854 8:93561218-93561240 CAGCACCAATAGGATGTGGCGGG + Intergenic
1045135960 8:99218719-99218741 CAGAATGAATGGGAGGTGGGTGG + Intronic
1045183243 8:99809554-99809576 CTGAATAATTAAGAGGTGTCTGG - Intronic
1045689953 8:104750010-104750032 GAGAATAAATTGGAGGTTGAAGG + Intronic
1046365728 8:113228645-113228667 CAGAATATGTGGGAGGTGGGAGG - Intronic
1046449719 8:114372561-114372583 CAGAACCAATAGGAGATGGACGG + Intergenic
1046996682 8:120531546-120531568 CACAAAAATTAGGAGGGGGCGGG + Intronic
1047731669 8:127733964-127733986 AAGAATAACAAGGAGGTGGCTGG + Intergenic
1047770087 8:128023937-128023959 CAGAATAGATAAGAAGTGCCTGG - Intergenic
1049287899 8:141786527-141786549 CAGCATAACTACGAGGTGGGGGG + Intergenic
1050851169 9:10288145-10288167 CAGAAAAAATTGGGGGTGGGGGG + Intronic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1057304145 9:93902776-93902798 CAGAAGAAATGAGGGGTGGCAGG + Intergenic
1058408365 9:104703154-104703176 ATAAATAAATAGGTGGTGGCTGG + Intergenic
1059146223 9:111902208-111902230 GAAAACAAATAGGAGATGGCTGG - Intronic
1059179596 9:112199385-112199407 TAGAATAAGTAGGAGTAGGCTGG - Intergenic
1062455515 9:136635517-136635539 CAGAATAAATATAAGGTCACTGG - Intergenic
1186357993 X:8807415-8807437 CAGAATGACTTCGAGGTGGCTGG + Intergenic
1186514516 X:10156727-10156749 CAGCATCAATGGGAGGTGGTGGG - Intergenic
1187044190 X:15629906-15629928 CAAAACAAATTGGAGGGGGCGGG - Intronic
1188984929 X:36760718-36760740 CAGCTTAAAAAGGATGTGGCAGG - Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1190328788 X:49223140-49223162 CAGCAGAAATGGGAGGGGGCAGG + Intronic
1190742675 X:53300322-53300344 GAGGATGAATAGGAGTTGGCTGG - Intronic
1190829185 X:54044816-54044838 CAAAATTAATAGGTGGCGGCGGG + Intronic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191786762 X:64924655-64924677 AAGAATCAATAGGAGTTCGCTGG + Intronic
1192090876 X:68154274-68154296 CAGCATAACTAGCAGATGGCAGG + Intronic
1193530904 X:82652436-82652458 CAGAATAAATGGGTGTTTGCAGG + Intergenic
1195333119 X:103822458-103822480 CAGAATAAAGTAGAGATGGCTGG + Exonic
1195683144 X:107563707-107563729 CATAAAAAATAGGTGGTGGGTGG + Intronic
1196461825 X:115940318-115940340 AAGAAGAAAGAGGAGGTTGCAGG - Intergenic
1199940009 X:152616014-152616036 CAGAATAACTAGGAGGTCAGTGG + Intergenic
1202025200 Y:20514623-20514645 CAAAATAAATAGAAAGTGGATGG - Intergenic