ID: 1053380441

View in Genome Browser
Species Human (GRCh38)
Location 9:37644956-37644978
Sequence TCATTCTGCTTTGCATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053380441_1053380448 18 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA No data
Right 1053380448 9:37644997-37645019 AGATGTAGTTGTCAAGACCAGGG No data
1053380441_1053380444 -7 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA No data
Right 1053380444 9:37644972-37644994 AGAATGAAGCCTATGGGAAGTGG No data
1053380441_1053380449 22 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA No data
Right 1053380449 9:37645001-37645023 GTAGTTGTCAAGACCAGGGTAGG No data
1053380441_1053380447 17 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA No data
Right 1053380447 9:37644996-37645018 CAGATGTAGTTGTCAAGACCAGG No data
1053380441_1053380450 23 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA No data
Right 1053380450 9:37645002-37645024 TAGTTGTCAAGACCAGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053380441 Original CRISPR TCATTCTGCTTTGCATCTGC TGG (reversed) Intronic