ID: 1053380441

View in Genome Browser
Species Human (GRCh38)
Location 9:37644956-37644978
Sequence TCATTCTGCTTTGCATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053380441_1053380444 -7 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1053380444 9:37644972-37644994 AGAATGAAGCCTATGGGAAGTGG No data
1053380441_1053380449 22 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1053380449 9:37645001-37645023 GTAGTTGTCAAGACCAGGGTAGG No data
1053380441_1053380447 17 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1053380447 9:37644996-37645018 CAGATGTAGTTGTCAAGACCAGG No data
1053380441_1053380450 23 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1053380450 9:37645002-37645024 TAGTTGTCAAGACCAGGGTAGGG No data
1053380441_1053380448 18 Left 1053380441 9:37644956-37644978 CCAGCAGATGCAAAGCAGAATGA 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1053380448 9:37644997-37645019 AGATGTAGTTGTCAAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053380441 Original CRISPR TCATTCTGCTTTGCATCTGC TGG (reversed) Intronic
901325346 1:8361972-8361994 TCATTCTGAGTTCCATCTCCAGG + Intronic
904084347 1:27894106-27894128 TCTTTCTGATTTGAATCTTCAGG - Exonic
906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG + Intergenic
907103530 1:51859459-51859481 TGATTCTGCCTTGCAGCTGGTGG - Intronic
909239975 1:73200249-73200271 TCATTCTATTTAGCATCTACTGG - Intergenic
909988681 1:82194538-82194560 TCTTTCTGCTTTTCAACTTCAGG - Intergenic
910528616 1:88210239-88210261 TGACTCTGCTTGCCATCTGCTGG - Intergenic
912872336 1:113320160-113320182 TCATTCTACTCTCCATCTCCAGG - Intergenic
913277084 1:117148916-117148938 ACATTCTGCTGTGCTCCTGCAGG - Intronic
913416233 1:118611722-118611744 TCATTCTGCTGTTGGTCTGCTGG + Intergenic
915039302 1:152954446-152954468 TTATTCTGCTGTTCTTCTGCGGG + Intergenic
915685190 1:157625411-157625433 TGAAACTGCTTTTCATCTGCTGG + Intergenic
918160253 1:181891688-181891710 TCTTTTTGCTTTCCATTTGCTGG - Intergenic
918416719 1:184316774-184316796 TCATTTGGCTTTGTATCTTCAGG + Intergenic
918833600 1:189430914-189430936 TCATTCATCATTGGATCTGCTGG - Intergenic
918934282 1:190899874-190899896 TCATTGTACTTTTCATCTGTAGG - Intergenic
919818805 1:201459763-201459785 TCTTTCTTCTTTGCAGCTGGGGG + Intergenic
919913856 1:202128351-202128373 TGCTGCTCCTTTGCATCTGCAGG + Exonic
920745603 1:208625115-208625137 TCTTGCTGCTTTGTAGCTGCTGG + Intergenic
920896163 1:210051730-210051752 TCCTTCTTTTTTACATCTGCAGG + Intronic
921813827 1:219544667-219544689 TCATCCCTCTTTTCATCTGCAGG - Intergenic
922374619 1:224949392-224949414 TCATTCTGCTTAGAATTTGTTGG + Intronic
922463289 1:225829044-225829066 TCAGTCTGCTTTTCCTCTGCTGG + Intronic
923377922 1:233384298-233384320 TCATACTGTTTCTCATCTGCTGG - Exonic
924061790 1:240182745-240182767 CCTTTCTGCTTTGCACCTGAGGG - Intronic
1063068551 10:2635815-2635837 TCCTCCTGCTTGGCACCTGCAGG + Intergenic
1063990106 10:11552251-11552273 TCATTCTGCTTTTCTTTTTCTGG - Intronic
1064491427 10:15861002-15861024 TAATTCTGCGTTGCAGCTGGTGG - Intergenic
1064897474 10:20254345-20254367 GCATCTTGCTTTGCAGCTGCTGG + Intronic
1065936631 10:30526245-30526267 TTATTCTGCTTGGGATCTGTGGG + Intergenic
1066019104 10:31278694-31278716 TCATACTGCTTTTCCTATGCTGG + Intergenic
1067055290 10:43046360-43046382 TCACTCTGCATGGCCTCTGCGGG - Intergenic
1068859655 10:61834564-61834586 TCATTATGCTCTGGAACTGCTGG - Intergenic
1069511119 10:69043243-69043265 CCATTCTGCCTTCCAGCTGCTGG + Intergenic
1069824804 10:71248369-71248391 TCATTCTGCTCTGGAGGTGCGGG - Intronic
1070672880 10:78390290-78390312 ACCTTCTGCTTTGCATCCTCTGG + Intergenic
1070699934 10:78594491-78594513 TCATTCATCTTTGCATCCCCAGG - Intergenic
1071672861 10:87626438-87626460 TGATTCTGCTTGGTAGCTGCTGG - Intergenic
1071935298 10:90523842-90523864 TCATTTTGCTATGCATTTCCTGG + Intergenic
1072001171 10:91197206-91197228 CCATTCCGCTTGGCATCAGCAGG + Intronic
1073726534 10:106237647-106237669 GCATTCTGCTGTGCACCAGCTGG - Intergenic
1073957896 10:108893359-108893381 TTTTACTGCTTTGCCTCTGCTGG + Intergenic
1075824484 10:125343092-125343114 TCATTCTACTTTCTATCTGTAGG + Intergenic
1076039195 10:127228371-127228393 TCACTTTGTTTTTCATCTGCTGG + Intronic
1076105405 10:127818596-127818618 TCATTCAGCTTTGTCTTTGCAGG + Intergenic
1076826094 10:132970317-132970339 TTATTCTGCTTTGGATTTGCTGG + Intergenic
1077901210 11:6490544-6490566 TCGTTCAGCTCTGTATCTGCAGG - Intronic
1078866465 11:15302497-15302519 TACTTCTGCTTTGCTTCTGGGGG + Intergenic
1079966471 11:26986224-26986246 TCATCCTTCTTTGCACATGCTGG + Intergenic
1082307101 11:50592794-50592816 TCTTTCTACTTTTCATCTGAAGG - Intergenic
1084073539 11:66754033-66754055 TCAGTCTTCCTTGCAACTGCAGG - Intronic
1085447864 11:76613068-76613090 TCATTCATTTTAGCATCTGCTGG - Intergenic
1085647260 11:78233361-78233383 AGATTCTGCTTTACCTCTGCTGG - Intronic
1085718010 11:78890020-78890042 TCTTGCTGCTCTCCATCTGCAGG - Exonic
1085883184 11:80491875-80491897 TGATTCTGCATTACATATGCGGG + Intergenic
1086547675 11:88016957-88016979 TCATTTTGCTTTGTAACTGTTGG - Intergenic
1087759910 11:102094316-102094338 TCATTCTGGTTGGCAACTGCAGG + Intergenic
1087979297 11:104591220-104591242 TTATTATGCTTTGGATCTCCAGG - Intergenic
1088571735 11:111229554-111229576 CCAATATGCTTTGTATCTGCTGG - Intergenic
1089977889 11:122748228-122748250 TCATTCTGCCTTTCAGCTGTAGG + Intronic
1091287288 11:134414693-134414715 TCTTCCTGCTTGGCCTCTGCAGG + Intergenic
1092985259 12:13838843-13838865 TTATGCTGCTTTGCATCAGCAGG - Intronic
1094421605 12:30277232-30277254 TCATCCTGCTCAGCATCTGCTGG + Intergenic
1094862763 12:34488224-34488246 TCTTTCTGCTTTTCATCTGAAGG + Intergenic
1095539447 12:43291611-43291633 TCTTTGTGCTTTGGGTCTGCTGG + Intergenic
1096484520 12:51969354-51969376 CCATTCACCTTTGCATCTCCAGG - Intronic
1096557791 12:52414128-52414150 CCATGCTGCTTGGCATCAGCAGG + Intergenic
1096942775 12:55366072-55366094 TCATTCAGCTTTGCCTTTGGGGG - Intergenic
1098584807 12:72142722-72142744 TCATTCTGCCATCCATCTGCTGG - Intronic
1100159414 12:91840960-91840982 TTATTCTGCCTTGTAGCTGCTGG + Intergenic
1100707019 12:97211874-97211896 ACCACCTGCTTTGCATCTGCTGG - Intergenic
1101010620 12:100445605-100445627 TCATTCTGCTTGGAATTTTCTGG - Intergenic
1104414118 12:128583860-128583882 TCATTCAGCTTTTTCTCTGCAGG - Intronic
1107149050 13:37090981-37091003 TCATTCCATTTGGCATCTGCAGG - Intergenic
1107988059 13:45792849-45792871 TGGCTCTGCTTTTCATCTGCGGG + Intronic
1110286669 13:73757607-73757629 TTGTTCTGGTTTTCATCTGCTGG - Intronic
1110453777 13:75667258-75667280 TTATTCTGCTTGGTATTTGCTGG + Intronic
1112107495 13:96257260-96257282 TCTATCTACTGTGCATCTGCAGG + Intronic
1117151411 14:52892131-52892153 TCTCTCTGCTTTGCATATTCTGG - Intronic
1119479510 14:74950831-74950853 TCATCCTGCTCTGCATCTGATGG + Intronic
1121999026 14:98630747-98630769 TCACTCAGCATTGCATCTCCTGG - Intergenic
1124172164 15:27385560-27385582 TCATTCTGTTTTCTTTCTGCTGG + Intronic
1126461139 15:48916246-48916268 TGAATCTGCTTTGCAGCTGATGG + Intronic
1126956481 15:53938187-53938209 TTTTTCTGCTTTCCATTTGCTGG - Intergenic
1128615172 15:69103225-69103247 TTATTGTGCTTTGCTTGTGCTGG + Intergenic
1128646075 15:69379861-69379883 TCCTTTTCCTTTGCCTCTGCAGG + Exonic
1129984320 15:79903859-79903881 GCATTCTCCTCTGCATATGCTGG - Intronic
1129991357 15:79966499-79966521 GCATTCTCCTCTGCATATGCTGG - Intronic
1131448940 15:92522955-92522977 TCATTCTGTTCTGAATCTCCAGG + Intergenic
1131522779 15:93128746-93128768 ACTTACTGATTTGCATCTGCTGG - Intergenic
1134295630 16:12943009-12943031 CAATTCTGGTTTGCAGCTGCTGG - Intronic
1135340620 16:21644156-21644178 ACATTTTCCTGTGCATCTGCAGG - Intronic
1136018799 16:27426533-27426555 TCATGCATCTTTGCCTCTGCTGG - Intronic
1136220637 16:28825518-28825540 TCATTCTGCCTTGTGTGTGCCGG - Intronic
1138640349 16:58380957-58380979 TCTTTTTGCTTTGCATTTCCTGG - Intronic
1139183085 16:64770578-64770600 TCATGCTGCTAGGCAGCTGCAGG - Intergenic
1139620008 16:68131622-68131644 TGATTGTGCTTGGTATCTGCTGG - Intronic
1140876599 16:79158391-79158413 CCATTCTGAATTGCAGCTGCAGG + Intronic
1140934409 16:79657192-79657214 TCATTCTTCTGAGGATCTGCAGG + Intergenic
1142279158 16:89138679-89138701 TCAGTCAGCTTGGCACCTGCAGG - Intronic
1144034936 17:11356589-11356611 TCCATCTGCTTGGCCTCTGCTGG + Intronic
1145977967 17:28995219-28995241 TCCCTCTGCTGAGCATCTGCAGG + Intronic
1146626783 17:34441085-34441107 TCATTGTGCTGTTCAGCTGCTGG - Intergenic
1146674913 17:34766590-34766612 TCCTTCTGCTTTGATTTTGCAGG + Intergenic
1147362357 17:39939151-39939173 TCAATCTCCTTTGCAGCTGAGGG - Intergenic
1147621637 17:41871958-41871980 TCATGCTGCTTTGCCACAGCAGG - Intronic
1148536771 17:48445580-48445602 TTCTTCTGCTTTGCATCCACAGG + Intergenic
1148791749 17:50177098-50177120 TCCTTCTCCTTTTCCTCTGCTGG + Intergenic
1149530618 17:57392038-57392060 CCAGGCTGCTCTGCATCTGCAGG - Intronic
1151310934 17:73291993-73292015 TCCTTCTGCTCTGGGTCTGCTGG - Intronic
1152415860 17:80161400-80161422 TCACTTTGCTTTCCATCTGCTGG + Intergenic
1155163384 18:23213506-23213528 TCATTAGGTTTTTCATCTGCTGG - Intronic
1155176024 18:23302073-23302095 TCATTCACCTTTGCATCTCTAGG - Intronic
1155271101 18:24141970-24141992 TCAGCCTGCTTTGTACCTGCAGG - Intronic
1156218722 18:35029284-35029306 TCACACTGCTTTCCAGCTGCCGG + Intronic
1156658209 18:39312589-39312611 TTATGTTGCTTTGCACCTGCAGG - Intergenic
1156689540 18:39691408-39691430 ACATTCTGCTTTGTATCTAATGG - Intergenic
1156697530 18:39784726-39784748 TCCATCTGCCTTTCATCTGCTGG - Intergenic
1157692754 18:49697367-49697389 CCTTACTGCTGTGCATCTGCGGG + Intergenic
1161640006 19:5416338-5416360 TCATTGTGGTTTGGATTTGCAGG + Intergenic
1164058939 19:21648470-21648492 TCAGTGTGTTTTGCATTTGCTGG + Intergenic
1164067732 19:21735080-21735102 TCAATGTGTTTTGCATTTGCTGG - Intronic
1164331337 19:24260644-24260666 TCTTTCTGATTTGTATCTGGGGG + Intergenic
1164332640 19:24274527-24274549 TCTTTCTGGTTTGTATCTGGGGG + Intergenic
1166571897 19:43802336-43802358 TCATTCTGCTCTGCCTCTTTGGG - Exonic
1167608409 19:50493885-50493907 TCCTTCTGCTTTTGCTCTGCGGG - Intergenic
1168635408 19:57992322-57992344 TCATACTGCATTGCATCAGTGGG - Intronic
925948148 2:8885786-8885808 TCATTCATATTTGCATCTTCAGG - Intronic
926295685 2:11566980-11567002 TCATTCTCCTCTGCCTCTGTAGG - Intronic
926394041 2:12423394-12423416 TCATTCCACTGTTCATCTGCGGG - Intergenic
928177680 2:29046195-29046217 TGTTTCTGCTTTGAGTCTGCAGG + Intronic
928690758 2:33796243-33796265 TAATTTTGTTTTTCATCTGCAGG + Intergenic
928778717 2:34794724-34794746 TCTTTTTACTTTGCATCTCCAGG + Intergenic
930234612 2:48876770-48876792 TCCTGGAGCTTTGCATCTGCAGG - Intergenic
931127971 2:59298572-59298594 ACTTTCTGCTTTGCCTCTGAAGG + Intergenic
933993545 2:87650936-87650958 CCATTCTGCTGAGCATCTGAAGG - Intergenic
936300318 2:111299947-111299969 CCATTCTGCTGAGCATCTGCAGG + Intergenic
939388585 2:141535141-141535163 TCACTCTCCTTAGCGTCTGCTGG + Intronic
939487185 2:142829196-142829218 TCATTCTGCTGTGCAGAAGCTGG + Intergenic
940538449 2:154978667-154978689 TCATTTTGGTTTGCATTTTCTGG - Intergenic
941085768 2:161115764-161115786 TCAATCTGCATTGCTTCTGTAGG - Intergenic
942696269 2:178650148-178650170 GGATTCTGCTTTGTACCTGCTGG + Exonic
945362191 2:208905588-208905610 TCATTTTGCTTTGCAAATTCAGG - Intergenic
945860133 2:215111864-215111886 TCATTCTTCTGTGCATTTACAGG - Intronic
946308341 2:218868840-218868862 TTATTTTCCTTTGCATCTCCTGG - Intronic
947674078 2:231961711-231961733 GCATTCTCCTTAGCAACTGCGGG + Exonic
948515941 2:238504047-238504069 TCATGCTATTCTGCATCTGCTGG + Intergenic
1169519213 20:6353009-6353031 TCAGACTGCTCTGCATCTCCAGG - Intergenic
1169896230 20:10508080-10508102 TGTTTCTGGTTTGCATCTGGGGG + Intronic
1171132826 20:22669964-22669986 TCTTTCTGCTTTGCTTCTCTGGG - Intergenic
1171165086 20:22962980-22963002 TCATTCAGCTCTGAATCAGCAGG + Intergenic
1171967940 20:31544471-31544493 ACATTCTGCTTTCCAACAGCAGG - Intronic
1172441264 20:34968249-34968271 TCCTTCAGCTTTGCATCTGCAGG - Intergenic
1174567169 20:51473548-51473570 TCATTGAGCTTTGACTCTGCTGG - Intronic
1177837781 21:26204701-26204723 GCATTCTGCTTAGGCTCTGCTGG + Intergenic
1178005663 21:28217332-28217354 TTGTTCTGTTTTCCATCTGCAGG + Intergenic
1179243981 21:39614412-39614434 TCTTTCCGATTTGCATCTCCAGG - Intronic
1180017161 21:45094943-45094965 TCATTCTGCTGCCCATGTGCTGG + Intronic
1181474999 22:23162563-23162585 TCTGTCTGCTCTGCATGTGCAGG - Exonic
1184019885 22:41813845-41813867 TGTGTCTGCTTTGCCTCTGCTGG + Intronic
1184956174 22:47887817-47887839 TCATTGTGCTTTGCATAGGAAGG + Intergenic
949931057 3:9078735-9078757 GCATATTGCTTTGCATCAGCTGG - Intronic
950970035 3:17177185-17177207 TCATTTTGCTTTCCATTTTCTGG - Intronic
951199940 3:19865023-19865045 TCCTCCTGCTTTACATTTGCTGG + Intergenic
953052672 3:39360052-39360074 ACATTCTCCTTTCCATCTGAAGG - Intergenic
954205559 3:49056404-49056426 TCATTCTGTTTTTCATCTTTGGG - Intronic
955072360 3:55582648-55582670 TCATACTGTTTTTCTTCTGCAGG + Intronic
956409587 3:68965758-68965780 TCATCCTTCTCTGCATCTCCAGG + Intergenic
957339464 3:78875761-78875783 TGATTCTGCTTTTAATCTCCAGG - Intronic
959376454 3:105593915-105593937 TTGTTCTGCTGTCCATCTGCTGG + Intergenic
961936606 3:130591233-130591255 TCATTGTGCTTTGCTTCTGGTGG + Intronic
962357190 3:134704899-134704921 TGATTCTGCTCTGCTTCTGTAGG - Intronic
963295368 3:143540278-143540300 TTATTCTGTTTTGCCTCTGCTGG - Intronic
963975784 3:151479066-151479088 TCTTGCTGCTATGCATTTGCAGG - Intergenic
963978249 3:151507115-151507137 TGATTCTGGCTTGCAGCTGCTGG - Intergenic
965343647 3:167520347-167520369 TCACTCTGCTATGCATGTGATGG + Intronic
965347887 3:167574895-167574917 TCATTTTGAATTCCATCTGCGGG - Intronic
965350211 3:167602266-167602288 TAATTCTGATTAGCAACTGCTGG - Exonic
966433654 3:179859668-179859690 TCCTTCTGCTTTCCCTCTGTTGG + Intronic
970887196 4:21000134-21000156 TCCTTCTGCTTAGCACCTGCTGG - Intronic
972095803 4:35345330-35345352 TCTGCCTGCTTTGTATCTGCTGG - Intergenic
975092138 4:70416366-70416388 TAGTTCTGATTTGCATGTGCAGG - Intergenic
975539101 4:75486029-75486051 TGATTCTGCTTTGTAGCTACAGG - Intronic
975950549 4:79764803-79764825 TGATTCTTCTTTGTTTCTGCTGG - Intergenic
976018115 4:80585093-80585115 TGATTTTGCAGTGCATCTGCTGG - Intronic
976032104 4:80768864-80768886 TCATTCTACCTTGTATCTGGTGG - Intronic
979322481 4:119340694-119340716 GCATTCTGCTTTGCTGCTTCAGG + Intergenic
979421306 4:120508947-120508969 TGCTTCTGCTTTCCCTCTGCGGG - Intergenic
980964574 4:139508760-139508782 TTTTTCTACTTTACATCTGCTGG - Exonic
982994606 4:162326027-162326049 TCATTAGGCATTGCATCTGAAGG - Intergenic
983240459 4:165226307-165226329 GCATTCTGCTTTGCTGCTTCAGG + Intronic
984114658 4:175664688-175664710 TCATTCTACTTCACATCTTCTGG + Intronic
986631377 5:9776783-9776805 ACATTCTGCCTTCCATCTACAGG + Intergenic
987616766 5:20284062-20284084 TCATTCTACTCTCCATCTCCAGG - Intronic
988340421 5:29962760-29962782 TATTTCTCCTTTGCATCTGAAGG - Intergenic
988750568 5:34188136-34188158 TAATTCTTCGGTGCATCTGCAGG - Intergenic
991059008 5:62351466-62351488 TCATTATGCTTTTCATGTCCTGG - Intronic
991285724 5:64973540-64973562 GCATTTTGATTGGCATCTGCAGG - Intronic
994303028 5:98169530-98169552 TCATTCTGCTCAGCATATTCTGG - Intergenic
994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG + Intergenic
995775639 5:115722412-115722434 TCATTCTTCATTGCATGTTCAGG - Intergenic
996923241 5:128793097-128793119 TTATTCTGCTATGCATCAGTGGG + Intronic
998557418 5:143139089-143139111 TCATTCAGCTGGGCATCTGCCGG + Intronic
1000075431 5:157780365-157780387 TGTTTCTGCTTTACATCTACTGG + Intergenic
1000204729 5:159047977-159047999 TCATTCATCTTTGCATCACCTGG + Intronic
1000317103 5:160103058-160103080 TCATTCTCCTTTACTTATGCTGG - Intronic
1000713356 5:164607998-164608020 TCAGTCTTCTTTGGATATGCAGG - Intergenic
1001288310 5:170439281-170439303 TCCTTCTTATTTGCATCTGGTGG - Intronic
1001534866 5:172491227-172491249 GCATTCTGCCTGGCATCTGCAGG + Intergenic
1002366991 5:178720959-178720981 TCATTCTGCTTTCAATATGTAGG + Intronic
1003146124 6:3512043-3512065 TCCTTGTGCTTTGCTTCTGATGG + Intergenic
1007200702 6:40106208-40106230 TCATTCTGCATTGAATCTTAGGG + Intergenic
1007298974 6:40851858-40851880 ACATTCTCCTTTGCATCCTCTGG - Intergenic
1008370191 6:50722887-50722909 TCATTCTGCCTTGCAGCCCCAGG + Intronic
1009759024 6:67979649-67979671 TAATGATGCTTTGCATCTGCAGG + Intergenic
1010623399 6:78105154-78105176 CCATTTTGCTTTGAATATGCAGG + Intergenic
1012226888 6:96714895-96714917 TCAGGCTGCTGGGCATCTGCAGG + Intergenic
1012863887 6:104595111-104595133 GCATTGTGGTGTGCATCTGCAGG + Intergenic
1012894074 6:104928969-104928991 TCATGCTGCTTTGCAGTTACAGG - Intergenic
1013856872 6:114583257-114583279 TCTGCCTGCTTTGTATCTGCTGG + Intergenic
1014116358 6:117672697-117672719 TGAACCTGCTTTGCATCTGGTGG - Intergenic
1014166388 6:118229840-118229862 TAATTTTGCTAAGCATCTGCAGG - Intronic
1017253724 6:152309888-152309910 TCATGCTGCTCTGCGGCTGCAGG - Exonic
1019867810 7:3729214-3729236 TCATTTTGTTTTGCATTTGCAGG + Intronic
1020882121 7:13775370-13775392 GCATTCTGCTCTACTTCTGCTGG + Intergenic
1020897037 7:13953091-13953113 TCGTGCTGCTTTCCATCTACTGG - Intronic
1022434397 7:30366926-30366948 TTATTGTGCTTTGCATCTCCAGG + Exonic
1023466724 7:40464229-40464251 TCTTTCAGCTCTGTATCTGCAGG - Intronic
1024254483 7:47530275-47530297 TCATTCACCTGTGCTTCTGCAGG - Intronic
1024970739 7:55067397-55067419 TCATTCTGCGTTGTCTATGCAGG - Intronic
1025576251 7:62645791-62645813 TCTTTCTACTTTGTATCTGAAGG + Intergenic
1029980098 7:104870678-104870700 TCTTTCTTCTCTGCATCAGCTGG - Intronic
1030045141 7:105488438-105488460 TCTTTTTTCTTTCCATCTGCTGG - Intronic
1032281036 7:130501561-130501583 TCATTCTGCCTGGCAACTCCAGG - Intronic
1033731829 7:144187794-144187816 TCATTCTGGTTGGTCTCTGCAGG + Exonic
1033742677 7:144286377-144286399 TCATTCTGGTTGGTCTCTGCAGG + Intergenic
1033751224 7:144363237-144363259 TCATTCTGGTTGGTCTCTGCAGG - Exonic
1035494492 7:159311333-159311355 TGATTCTGCCTTGTAGCTGCTGG - Intergenic
1035613863 8:988239-988261 AAATTCTGTTTTGCATCTGAAGG - Intergenic
1038473014 8:27841207-27841229 TCATTCTAATTTTCTTCTGCAGG + Intergenic
1038988324 8:32837696-32837718 TCTTTCTGTTTTGCATCTTTGGG - Intergenic
1041423797 8:57697484-57697506 TTTTTCTGCTTTCCATTTGCTGG - Intergenic
1041581922 8:59470888-59470910 TTGTTCTGCTTTGCTTTTGCTGG + Intergenic
1043804504 8:84654609-84654631 TCCTTCTACTTTACATCTCCAGG + Intronic
1044416052 8:91941691-91941713 GCAATCTGATTTGCATTTGCTGG - Intergenic
1050569768 9:6925503-6925525 TCATGCTGCTTTCAATCTCCTGG + Intronic
1053380441 9:37644956-37644978 TCATTCTGCTTTGCATCTGCTGG - Intronic
1053615151 9:39757855-39757877 TCATTGACCTTTCCATCTGCAGG + Intergenic
1053873318 9:42517116-42517138 TCATTGACCTTTCCATCTGCAGG + Intergenic
1054238369 9:62584535-62584557 TCATTGACCTTTCCATCTGCAGG - Intergenic
1054262221 9:62878772-62878794 TCATTGACCTTTCCATCTGCAGG + Intergenic
1054269011 9:62949636-62949658 TCATTGACCTTTCCATCTGCAGG - Intergenic
1054552498 9:66619055-66619077 TCATTGACCTTTCCATCTGCAGG - Intergenic
1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG + Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1055553013 9:77448353-77448375 TCATTCTGGTTTTCATTTTCAGG + Intronic
1057113632 9:92499594-92499616 TCATACTGCATTGCATCAGAAGG - Intronic
1058088460 9:100776990-100777012 TCATTCTAACTGGCATCTGCTGG + Intergenic
1059268758 9:113059923-113059945 TCTTTCTGCTCTGCTGCTGCCGG + Intergenic
1059269894 9:113065372-113065394 TCTTTCTGCTCTGCTGCTGCCGG + Intergenic
1059271028 9:113070820-113070842 TCTTTCTGCTCTGCTGCTGCCGG + Intergenic
1059272161 9:113076266-113076288 TCTTTCTGCTCTGCTGCTGCCGG + Intergenic
1059273296 9:113081708-113081730 TCTTTCTGCTCTGCTGCTGCCGG + Intergenic
1059274432 9:113087154-113087176 TCTTTCTGCTCTGCTGCTGCCGG + Intergenic
1060002661 9:119972674-119972696 TAATTCTGCTTTGCCTGGGCTGG - Intergenic
1060315573 9:122507253-122507275 CCATTCTTCTTTTCATCTTCAGG - Intergenic
1061524197 9:131144618-131144640 TCATTCTCCTTTGGATCATCTGG + Exonic
1061829007 9:133278690-133278712 CCATTCTGGTTTGCATGTGTTGG + Intergenic
1062471840 9:136709590-136709612 ACGTTCTCCTTTGCATCTGCAGG - Intergenic
1188265818 X:28072714-28072736 TCATTCTACTTTCCATCTCCAGG - Intergenic
1190623758 X:52315539-52315561 TGCTTCTGCTTGGCATCCGCAGG - Intergenic
1191760328 X:64640839-64640861 TCATTTTGCTTTGAGTCTGTGGG + Intergenic
1193621495 X:83757227-83757249 CCATTCTGATTGTCATCTGCAGG - Intergenic
1193814827 X:86091922-86091944 TCATTCTGGTTTTCATGTCCTGG - Intergenic
1194569450 X:95535906-95535928 TGATTCTGATTTGTAACTGCTGG + Intergenic
1195262714 X:103149258-103149280 TTAGTCTACTTTGCCTCTGCTGG - Intergenic
1197097442 X:122612690-122612712 TCAATCACCTTTGGATCTGCTGG - Intergenic
1197552239 X:127905715-127905737 TCTGCCTGCTTTGCATTTGCTGG - Intergenic
1197765684 X:130058200-130058222 CCATCCTGCTTTGCAGCTGTGGG + Intergenic
1198564821 X:137893698-137893720 CCATTCTGCTGTGCTTCTGGTGG + Intergenic
1199629103 X:149763536-149763558 TTATTCATCTTTACATCTGCTGG + Intergenic