ID: 1053380444 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:37644972-37644994 |
Sequence | AGAATGAAGCCTATGGGAAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053380440_1053380444 | -6 | Left | 1053380440 | 9:37644955-37644977 | CCCAGCAGATGCAAAGCAGAATG | No data | ||
Right | 1053380444 | 9:37644972-37644994 | AGAATGAAGCCTATGGGAAGTGG | No data | ||||
1053380441_1053380444 | -7 | Left | 1053380441 | 9:37644956-37644978 | CCAGCAGATGCAAAGCAGAATGA | No data | ||
Right | 1053380444 | 9:37644972-37644994 | AGAATGAAGCCTATGGGAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053380444 | Original CRISPR | AGAATGAAGCCTATGGGAAG TGG | Intronic | ||