ID: 1053380817

View in Genome Browser
Species Human (GRCh38)
Location 9:37648872-37648894
Sequence CTCTGGGTTTGGAAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053380811_1053380817 17 Left 1053380811 9:37648832-37648854 CCTGAGGGACATTTAGGCGATGT 0: 1
1: 0
2: 1
3: 1
4: 54
Right 1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG No data
1053380813_1053380817 -6 Left 1053380813 9:37648855-37648877 CCAGCAGGCAGTTGTGTCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053380817 Original CRISPR CTCTGGGTTTGGAAGACAGA AGG Intronic
No off target data available for this crispr