ID: 1053387221

View in Genome Browser
Species Human (GRCh38)
Location 9:37702610-37702632
Sequence CTGGAGTGAAGGCCTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053387212_1053387221 16 Left 1053387212 9:37702571-37702593 CCAAGGCCCAGGGGTAAAACTGT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG No data
1053387213_1053387221 10 Left 1053387213 9:37702577-37702599 CCCAGGGGTAAAACTGTTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 95
Right 1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG No data
1053387215_1053387221 9 Left 1053387215 9:37702578-37702600 CCAGGGGTAAAACTGTTAGAGGT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053387221 Original CRISPR CTGGAGTGAAGGCCTGGGAA GGG Intronic
No off target data available for this crispr