ID: 1053387537

View in Genome Browser
Species Human (GRCh38)
Location 9:37706358-37706380
Sequence AAGTGAGGGCCTATTGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053387532_1053387537 28 Left 1053387532 9:37706307-37706329 CCTTGTTGAAACTGGAGATCATT 0: 1
1: 0
2: 1
3: 46
4: 410
Right 1053387537 9:37706358-37706380 AAGTGAGGGCCTATTGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053387537 Original CRISPR AAGTGAGGGCCTATTGCATT AGG Intronic
No off target data available for this crispr