ID: 1053387800

View in Genome Browser
Species Human (GRCh38)
Location 9:37708439-37708461
Sequence CAGGCTCATTGTTCATTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053387800_1053387807 18 Left 1053387800 9:37708439-37708461 CCTCCAAATGAACAATGAGCCTG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1053387807 9:37708480-37708502 AACGAGCAGTCGATATTCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1053387800_1053387802 -6 Left 1053387800 9:37708439-37708461 CCTCCAAATGAACAATGAGCCTG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1053387802 9:37708456-37708478 AGCCTGCTGAAGACCTTTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 151
1053387800_1053387803 -5 Left 1053387800 9:37708439-37708461 CCTCCAAATGAACAATGAGCCTG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1053387803 9:37708457-37708479 GCCTGCTGAAGACCTTTCCTGGG 0: 1
1: 0
2: 5
3: 18
4: 215
1053387800_1053387808 28 Left 1053387800 9:37708439-37708461 CCTCCAAATGAACAATGAGCCTG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1053387808 9:37708490-37708512 CGATATTCTCAGGTACTAAATGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053387800 Original CRISPR CAGGCTCATTGTTCATTTGG AGG (reversed) Exonic
901943257 1:12680141-12680163 CAGCCTCATTGCTTCTTTGGGGG - Intergenic
905269462 1:36777684-36777706 CAGGCTTATATTTTATTTGGAGG + Intergenic
905475207 1:38221491-38221513 CAGTCTCCTGGTTCATTAGGAGG - Intergenic
906785734 1:48614285-48614307 CAAGGTCATTGGTGATTTGGTGG - Intronic
908383847 1:63621802-63621824 CAGGCCCATTTGTCATTTGAAGG + Intronic
910241608 1:85092693-85092715 CAGGATAATTTTTCATTTTGGGG + Intronic
911169551 1:94756640-94756662 CAGGCTCATTGTACCTAGGGAGG - Intergenic
912974593 1:114316396-114316418 AAGGCGCATTCTTCATGTGGTGG - Intergenic
919369414 1:196705101-196705123 AAGTCTCATTTTTCAATTGGAGG - Intronic
920521209 1:206628175-206628197 CAGTCCCATTGTTCTTTTAGAGG + Intergenic
924123706 1:240828265-240828287 CAAGCTCCTTGTATATTTGGAGG + Intronic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
1062780251 10:198206-198228 CAGGCAAAGTTTTCATTTGGGGG - Intronic
1065613022 10:27491211-27491233 CTGGCTTATTGTTGGTTTGGTGG + Intergenic
1066680178 10:37930541-37930563 CAGGCTCATTGTGCAAATGCTGG + Intergenic
1071259848 10:83909763-83909785 CAGGCTGATGGTTCTTTTGAGGG + Intergenic
1073417978 10:103400416-103400438 CTGGCTCTTTTTTCTTTTGGTGG - Exonic
1075549240 10:123379829-123379851 CAGGCTCATGGTTGGTTTGTTGG - Intergenic
1075883536 10:125876240-125876262 CAGCCTCTTTGTCAATTTGGAGG - Intronic
1078174130 11:8956068-8956090 CAGGCCCATTATTCCTTTTGGGG + Intronic
1079518708 11:21299351-21299373 CAGGATCACAGTACATTTGGAGG + Intronic
1080288718 11:30645961-30645983 ATGGCTCATGGTGCATTTGGGGG - Intergenic
1082599235 11:55128632-55128654 CTGGCTGATTGTTCCTCTGGAGG - Intergenic
1085999616 11:81966156-81966178 CAAGATGATTGTTCATTTTGTGG + Intergenic
1088470556 11:110184448-110184470 CTTGCTCTCTGTTCATTTGGGGG - Intronic
1089810610 11:121128347-121128369 AAGGCTCCTTGCTCCTTTGGAGG + Intronic
1090484327 11:127098972-127098994 CAGGCTCATTGCTCATTCACTGG - Intergenic
1091133926 11:133170853-133170875 CTGGCTAATTGTGCTTTTGGGGG - Intronic
1092161248 12:6316585-6316607 CAGGCTCCTTGTTCTTCTGGAGG + Intronic
1093347233 12:18053243-18053265 CAGGCTCATTCCTAATTTTGTGG + Intergenic
1094641787 12:32282883-32282905 CAGGTTCAGTGTTCTTTGGGAGG + Intronic
1096763431 12:53862676-53862698 CTGGCTAATTGTTTTTTTGGCGG + Intergenic
1097569718 12:61317520-61317542 CTGTCTGATTGTTCCTTTGGAGG - Intergenic
1098450129 12:70610135-70610157 CCGGCGCATTGTTCCTTTGCCGG - Intronic
1099607253 12:84820103-84820125 TTGGCTCTTTGTTAATTTGGAGG + Intergenic
1101238263 12:102812182-102812204 CCTGTTCATTGTTCAGTTGGAGG + Intergenic
1102993936 12:117333889-117333911 GATGCTCACTGTTCAGTTGGTGG + Intronic
1108062449 13:46546877-46546899 CAGGCCTGTTGTTCATTAGGTGG - Intergenic
1108223491 13:48263366-48263388 CAGGCTCATTATTCATTCTAGGG + Exonic
1110009829 13:70318033-70318055 TTGGCTCCTTGTGCATTTGGGGG + Intergenic
1110256061 13:73435178-73435200 TATGCTCTTTGGTCATTTGGAGG - Intergenic
1113639280 13:111945519-111945541 CATGCGCATTGTTCACCTGGGGG - Intergenic
1113823816 13:113234651-113234673 CAAGGTGGTTGTTCATTTGGGGG - Intronic
1115540685 14:34417692-34417714 CAGGCACAATCTTCATATGGCGG + Intronic
1118761300 14:68881811-68881833 CAGGCTCATTGCTCAGGAGGAGG + Intronic
1118923150 14:70168176-70168198 CAGGGTCATTGTCTATTTTGTGG - Exonic
1123001632 14:105298502-105298524 GAGGCTCATTGTTTATCTGGAGG - Intronic
1125790121 15:42358929-42358951 CAGTCCCAGTGTTCATTTTGTGG + Intergenic
1126377595 15:48011857-48011879 GAGCATCACTGTTCATTTGGGGG + Intergenic
1128420333 15:67486002-67486024 CAGTCTTATTGCTCATTTGAAGG - Intronic
1131205823 15:90445715-90445737 TGTTCTCATTGTTCATTTGGAGG + Intronic
1133146063 16:3787517-3787539 CAGGCCCTTTGTTCACTTGAGGG - Intronic
1136145824 16:28316096-28316118 CAGGCGCAGTGTTCATTAGTCGG + Intronic
1143322401 17:6076622-6076644 CAGGCTCATTGTCCATTAAATGG - Intronic
1143686729 17:8523470-8523492 CAGGCCCATTGTTAATTTTGGGG - Intronic
1146500565 17:33360952-33360974 CAGGCTCACTGTTCTTCTGATGG - Intronic
1150695325 17:67400038-67400060 CATGGTCATTGTCCATTTGTGGG + Intronic
1151470205 17:74313316-74313338 CAGGTGCATTTTGCATTTGGGGG + Intronic
1153904501 18:9649340-9649362 CAGGCACATTGTAGATTTGTGGG - Intergenic
1154334377 18:13454171-13454193 CAGACTCAGTGTTCACGTGGAGG + Intronic
1158414070 18:57233904-57233926 AAGGCAGATTCTTCATTTGGGGG + Intergenic
1160518711 18:79492280-79492302 CAGCCTCATTTTTCATTTTGAGG - Intronic
1162582929 19:11541259-11541281 CAGGATCATGGTTGTTTTGGGGG - Intronic
1168390318 19:56001664-56001686 CAGGCTGATTTTTACTTTGGTGG + Intronic
930800465 2:55438135-55438157 CAGGCACTTTGTTCCTGTGGGGG - Intergenic
931549232 2:63424354-63424376 CTGGCTCAGTGGTCAGTTGGGGG - Intronic
934550812 2:95260482-95260504 AAGGCCCAATCTTCATTTGGGGG + Intergenic
935452030 2:103221032-103221054 CAGAATCATTGTTCCTGTGGGGG + Intergenic
935701311 2:105814521-105814543 CCAGCTCATTGTTCTTTTGCGGG + Intronic
939784508 2:146493529-146493551 CAGGGACTTTCTTCATTTGGTGG + Intergenic
942203381 2:173594191-173594213 CAGGCACAGTCTTCATATGGTGG + Intergenic
943077146 2:183209328-183209350 CAGGATCATTGTTAATTTCCAGG - Intergenic
943471075 2:188293608-188293630 AAGGCTACTTGTTCATATGGGGG - Intronic
943905860 2:193501076-193501098 CAGGCTCATAGATAATTTGAAGG + Intergenic
945063583 2:205929380-205929402 CAGGCTCACTGTACAACTGGTGG - Intergenic
947007218 2:225526078-225526100 CAAGCTGAATCTTCATTTGGAGG - Intronic
947110957 2:226719298-226719320 CAGGCTCCTTCTTCATAAGGCGG + Intergenic
947237558 2:227958625-227958647 CAAGATCATTGATCATTTGGGGG + Intergenic
948486602 2:238285297-238285319 CAGGCTCTCTGTTCTTGTGGTGG - Intronic
1169567013 20:6865909-6865931 CAGGTTCAGGGTTAATTTGGAGG + Intergenic
1170397033 20:15937365-15937387 CAGGCTCATGCTTTCTTTGGTGG + Intronic
1170849469 20:19991423-19991445 CAGGATAATTCTTCTTTTGGGGG + Intronic
1173380235 20:42533279-42533301 CAAGCTCAGTGTTCCTTTGCAGG + Intronic
1174914380 20:54639417-54639439 CAGAGTCATTGTTACTTTGGGGG - Intronic
1174979488 20:55377219-55377241 TAGGATTTTTGTTCATTTGGAGG - Intergenic
1177304743 21:19299154-19299176 CCTGCTCATTGTTCACTAGGTGG - Intergenic
1177440729 21:21120578-21120600 CAGGCTCCTTTTTCATTTCAGGG - Intronic
1178591318 21:33913351-33913373 CTGGCTCACTGTTGATTTGGTGG + Intronic
1180602676 22:17032797-17032819 CAGGCACAGGGGTCATTTGGGGG - Intergenic
955179457 3:56653496-56653518 CAGTCTAATTGTTCCTTTGTAGG - Intronic
955188641 3:56739185-56739207 CAGTCCCATTGTTCTTGTGGTGG + Intronic
955757757 3:62242955-62242977 AAGGGTCCCTGTTCATTTGGCGG - Intronic
955834767 3:63042957-63042979 CAGAAACATTGTTCCTTTGGGGG + Intergenic
961076888 3:123991092-123991114 CAGGTTGATTCTTCCTTTGGAGG + Intronic
961307694 3:125970218-125970240 CAGGTTGATTCTTCCTTTGGAGG - Intronic
964435357 3:156645606-156645628 CAAGCTCATGGTTCATTTTCGGG + Intergenic
965564607 3:170100896-170100918 GAGCCTGATTTTTCATTTGGGGG - Intronic
966069008 3:175851817-175851839 CAGGATCATGGTTCATGTGGAGG + Intergenic
972171253 4:36348378-36348400 GAGGCATTTTGTTCATTTGGTGG - Intergenic
976530222 4:86143101-86143123 CAGGCACATTCTTCATAGGGTGG + Intronic
978943835 4:114470782-114470804 AAGGCTCAGTGTTCCTTTGCAGG + Intergenic
979345467 4:119581550-119581572 CAGGCACATCTTCCATTTGGAGG - Intronic
982936872 4:161489960-161489982 CAGCCTGATTTTTCATTTAGTGG + Intronic
986990090 5:13542269-13542291 CAGGCTGAGTGCTCATATGGAGG + Intergenic
988551830 5:32207234-32207256 CTGGCTCACTGTTCAAATGGGGG + Intergenic
991200965 5:63991999-63992021 CAGGCTAATAGTTCTTTTGCGGG + Intergenic
994034350 5:95181351-95181373 CAAGCTCATTCCTCTTTTGGGGG + Intronic
994129216 5:96205335-96205357 CAGGCTCAGGGTACATTTGCAGG + Intergenic
996520452 5:124420410-124420432 CAGAGACATTGTCCATTTGGGGG + Intergenic
1001723802 5:173879376-173879398 CTGGCTCATTTTTTATTTAGAGG - Intergenic
1002923098 6:1587095-1587117 CAGGGTCATTTTTCCCTTGGGGG - Intergenic
1003656356 6:8013887-8013909 CAGGCTCATCAATCATTTGCTGG - Exonic
1006196464 6:32245731-32245753 CAGGCCCACTGTTCACTAGGTGG - Intergenic
1009527247 6:64763359-64763381 CAAGCTCCTTCTTCATATGGTGG + Intronic
1010063177 6:71648075-71648097 CAGTGTCATTGTTCATTTGAAGG + Intergenic
1011146220 6:84220149-84220171 CAGGCTCAATTTTCATGGGGAGG + Intronic
1013191276 6:107806191-107806213 CTTGCTCATTGTTTATTGGGGGG - Intronic
1014318916 6:119901406-119901428 CAGGCTCATTAATCATGTAGGGG + Intergenic
1014839655 6:126203435-126203457 CAGACTCCTGGTACATTTGGAGG - Intergenic
1014873905 6:126631821-126631843 ATGACTCAGTGTTCATTTGGGGG - Intergenic
1017102115 6:150857992-150858014 CAGGCTCCTTCTGCATTTGGGGG + Intergenic
1023559831 7:41462316-41462338 CCTGCTCATCGTTCACTTGGAGG + Intergenic
1024628482 7:51228761-51228783 CAGGCTCTTTCTTCACTTGCTGG - Intronic
1028480209 7:91296254-91296276 TAGGCTCATTTTACAGTTGGGGG - Intergenic
1029196142 7:98806809-98806831 GAGGCACATAGTTTATTTGGAGG - Intergenic
1033491107 7:141844884-141844906 CAGGCTCCTTTATCTTTTGGGGG - Intergenic
1037234727 8:16704375-16704397 CAGGCTCATAATTCAATTGAAGG + Intergenic
1037739532 8:21596478-21596500 CAGGCTGATTTCTCATCTGGTGG - Intergenic
1038532388 8:28328924-28328946 TAGGCTCAGTGTTCATGTAGAGG - Intronic
1041327762 8:56687353-56687375 TAGGCTCAGTGTGCATCTGGAGG + Intergenic
1041940344 8:63380840-63380862 CAAGCACCTTGTTCATGTGGTGG - Intergenic
1044271019 8:90244037-90244059 CATATTCATTGTTTATTTGGGGG - Intergenic
1050251145 9:3746137-3746159 CCAGCTCAATGTTCATTTGCGGG + Intergenic
1050616438 9:7406122-7406144 CAGTCACATTCTTCATTAGGTGG - Intergenic
1053387800 9:37708439-37708461 CAGGCTCATTGTTCATTTGGAGG - Exonic
1055739417 9:79369548-79369570 CAGCCTCATAGTTCATTGCGAGG + Intergenic
1056019826 9:82430278-82430300 CAGCCTCCTTTTTCATTAGGTGG + Intergenic
1058481328 9:105398496-105398518 CAGGCTCTTTAATCATTAGGTGG - Intronic
1059099835 9:111459575-111459597 CTGGCTCAGTTTTCCTTTGGTGG - Intronic
1062371479 9:136241372-136241394 CAGGCTCATTGTCCGTTTACTGG - Intronic
1187965989 X:24612257-24612279 CAGGCTCAGTTCTCATCTGGAGG - Intronic
1188643462 X:32535342-32535364 CCTCCTAATTGTTCATTTGGAGG + Intronic
1188865062 X:35304486-35304508 CAAGCACATTCTTCACTTGGTGG - Intergenic
1189669946 X:43397336-43397358 CTGGCTGACAGTTCATTTGGAGG - Intergenic
1196114609 X:111985462-111985484 CAAGGTAATTGTGCATTTGGGGG - Intronic
1196739501 X:119012104-119012126 AAGGATCATTGTCCCTTTGGTGG + Intronic