ID: 1053389347

View in Genome Browser
Species Human (GRCh38)
Location 9:37723102-37723124
Sequence TGTAATGAAATATCACCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053389347_1053389352 1 Left 1053389347 9:37723102-37723124 CCCTTTGGTGATATTTCATTACA 0: 1
1: 0
2: 1
3: 40
4: 390
Right 1053389352 9:37723126-37723148 GGAATGCAGCAATAAAATGAGGG No data
1053389347_1053389354 10 Left 1053389347 9:37723102-37723124 CCCTTTGGTGATATTTCATTACA 0: 1
1: 0
2: 1
3: 40
4: 390
Right 1053389354 9:37723135-37723157 CAATAAAATGAGGGTAGGAGAGG No data
1053389347_1053389351 0 Left 1053389347 9:37723102-37723124 CCCTTTGGTGATATTTCATTACA 0: 1
1: 0
2: 1
3: 40
4: 390
Right 1053389351 9:37723125-37723147 GGGAATGCAGCAATAAAATGAGG No data
1053389347_1053389353 5 Left 1053389347 9:37723102-37723124 CCCTTTGGTGATATTTCATTACA 0: 1
1: 0
2: 1
3: 40
4: 390
Right 1053389353 9:37723130-37723152 TGCAGCAATAAAATGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053389347 Original CRISPR TGTAATGAAATATCACCAAA GGG (reversed) Intronic
902651337 1:17839601-17839623 TGTAATGAAATAGCATGAACTGG - Intergenic
903096535 1:20980887-20980909 CATAATGAAAAATCACAAAAGGG + Intronic
903900543 1:26641761-26641783 TGTAATGATATGTGACCAAATGG - Intergenic
904972790 1:34432191-34432213 TGGAAATAAATATCTCCAAATGG + Intergenic
906042295 1:42797262-42797284 TGTAAAGCAAAATCAGCAAAGGG + Intergenic
906313222 1:44768623-44768645 GGTAATGAGGTATCACTAAAAGG - Intergenic
906484742 1:46225560-46225582 TGTAATGAATTACCACAAAGTGG + Intergenic
907146430 1:52237301-52237323 TGCAATTATATGTCACCAAATGG - Intronic
908080391 1:60571388-60571410 TGTAATGAAACATCATTGAAGGG + Intergenic
911356669 1:96829768-96829790 CGTAATGAAATTCCACCACAGGG + Intergenic
911764248 1:101655178-101655200 TATAATGAAATATCACAGACTGG - Intergenic
912113222 1:106370126-106370148 TGTAAGCAACTATCACCCAAGGG + Intergenic
913115759 1:115695425-115695447 TATAATGAAATACGACCACAAGG - Exonic
913549118 1:119899304-119899326 TGTAAAGACATATCAGAAAATGG - Intergenic
913938705 1:125083053-125083075 TCGAATGGAATATCATCAAACGG - Intergenic
916238824 1:162618198-162618220 TGCATTTAAATGTCACCAAAAGG - Intergenic
918190179 1:182166153-182166175 TGTAATGACAAATCTCCAGAGGG + Intergenic
918899039 1:190388703-190388725 TGTAATAAATTATCACAAACTGG - Intronic
919178855 1:194056346-194056368 TGCAATGAAATACCACAAACTGG + Intergenic
921589182 1:216983915-216983937 TATAAGGATATTTCACCAAATGG - Intronic
922135476 1:222821136-222821158 TGCAATGAAATACAGCCAAAAGG - Intergenic
922409800 1:225361265-225361287 TAAAATGAATCATCACCAAAAGG - Intronic
922893676 1:229082426-229082448 TGTAACAAAATACCACAAAATGG - Intergenic
1062895709 10:1101635-1101657 TGTGATGCAAAATCACCAGACGG - Intronic
1063231553 10:4070565-4070587 TATAATCAAATATCACTAAGTGG + Intergenic
1063584189 10:7336487-7336509 TGTAATGAGATATCAGGATAAGG + Intronic
1064722888 10:18247637-18247659 TGTAATGAAATAGCATCAATTGG + Intronic
1065032668 10:21603640-21603662 TGTAACAAAATATCACAAACTGG + Intronic
1066766254 10:38805518-38805540 TCAAATGAAATATAATCAAATGG - Intergenic
1066767273 10:38814122-38814144 TTGAATGGAATATAACCAAATGG - Intergenic
1068773246 10:60845581-60845603 TGTAATTACATATTACAAAATGG - Intergenic
1069068569 10:63972181-63972203 TGTGATGTAATATAACCAAGTGG + Intergenic
1069718693 10:70536766-70536788 TGGGATTAAATTTCACCAAAGGG + Intronic
1071201575 10:83224651-83224673 TGGACTGAAATATCCACAAAGGG - Intergenic
1073283786 10:102374821-102374843 TGTAAAGAAATAATACAAAAAGG - Intronic
1073580232 10:104659063-104659085 TTTAAGGAAATATCACAACATGG + Intronic
1074064629 10:110002754-110002776 TTTAATGAAATATCACCCTTAGG - Intronic
1074489581 10:113927166-113927188 TGTAATGAAATATCTCACACTGG - Intergenic
1075158782 10:120004449-120004471 TGTAATGAAATGCCACAAACTGG + Intergenic
1075901439 10:126045682-126045704 TGAACTGAAATATTTCCAAAAGG - Intronic
1078603396 11:12753546-12753568 TTTTATGAAACATAACCAAATGG - Intronic
1079499748 11:21089816-21089838 TCTTTTGAAATATCCCCAAATGG - Intronic
1079796273 11:24807079-24807101 TGTAATGACCTATAACCAGAGGG - Intronic
1080294270 11:30707448-30707470 TGTGATGAATTATCACCAGCAGG - Intergenic
1080928097 11:36779232-36779254 TGTAATGAAATCTAAACAACTGG + Intergenic
1081059297 11:38453084-38453106 TATATTGATCTATCACCAAATGG - Intergenic
1081403187 11:42666245-42666267 TCAAATGAGATCTCACCAAATGG + Intergenic
1084401304 11:68945035-68945057 TGAACAGAAATTTCACCAAAGGG - Intergenic
1085110206 11:73881133-73881155 TGTAATAAACTGTAACCAAAAGG + Intronic
1087989625 11:104732461-104732483 CATAATGAAATACCACCAACTGG + Intergenic
1088569648 11:111210633-111210655 TTTAATGAAATCCCACCCAATGG - Intergenic
1090140264 11:124250712-124250734 GGTAATATAATCTCACCAAATGG - Intergenic
1091074401 11:132601579-132601601 TGAAATGAAATCTCATCAAGTGG + Intronic
1091111001 11:132967513-132967535 AGTAATGAAATAACACCAGATGG - Intronic
1092482196 12:8870060-8870082 TGGAATGGAATATCATGAAAAGG - Intronic
1092807857 12:12243163-12243185 AATAAAGAAATATCACAAAATGG + Intronic
1097457098 12:59812923-59812945 TGGAATGAACTAGGACCAAAGGG - Intergenic
1097630633 12:62057955-62057977 TTTAATGAAGGATCACCCAATGG + Intronic
1097649694 12:62281744-62281766 AGCAATTAAATATCATCAAATGG + Intronic
1098351639 12:69568381-69568403 TTAAATAAAAAATCACCAAAGGG - Intronic
1098976758 12:76910438-76910460 TGTTAGGAAATATCACCAGCAGG - Intergenic
1099934037 12:89104641-89104663 CGTAACAAAATATCACAAAATGG + Intergenic
1100085927 12:90910727-90910749 TGTAATGTGATATCACCTTATGG - Intronic
1101198543 12:102410665-102410687 TGCATTGAAATGACACCAAAAGG - Intronic
1101285445 12:103307127-103307149 TGTAATAAATTACCACAAAATGG - Intronic
1101884135 12:108647280-108647302 TGAAATGGAATGTCTCCAAATGG + Exonic
1102788794 12:115626010-115626032 TTTAATGAAACATCTTCAAAAGG - Intergenic
1102988644 12:117298839-117298861 TGTAATAAAACACCACCAACTGG - Intronic
1105395130 13:20024884-20024906 TTTACTGAAATATCAACTAAAGG - Intronic
1105406220 13:20134708-20134730 TGTAATGAAAACTCATAAAATGG + Intergenic
1105468016 13:20665382-20665404 TTTTAAGAAATATAACCAAAAGG - Intronic
1105621640 13:22073141-22073163 TATAATGAAAGATCAACAGAAGG - Intergenic
1105657701 13:22458475-22458497 TGTAATGAAATATCATAAAGTGG - Intergenic
1105912419 13:24882570-24882592 TGTAATGTAATGTCTCAAAATGG - Intronic
1105914871 13:24904623-24904645 TGGAATGAAATATCCCAAAATGG + Intronic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1107284166 13:38771388-38771410 GGAAATGAAATATCAAAAAATGG - Intronic
1107829834 13:44364704-44364726 TGTGACAAAATATCAGCAAAGGG - Intergenic
1108175973 13:47792663-47792685 TGTAATGGTATAAGACCAAAAGG + Intergenic
1109136983 13:58664249-58664271 TGTTATGAAATTTCCCCAAAGGG - Intergenic
1109390978 13:61692681-61692703 TGTAATTATATCTCAACAAATGG - Intergenic
1110719454 13:78745110-78745132 AATAATGAAATATCAGCAATAGG - Intergenic
1110867335 13:80409893-80409915 TGTAATGGAATATCACAACTAGG + Intergenic
1111014957 13:82367917-82367939 TGTATTCAGATATTACCAAATGG - Intergenic
1113168716 13:107473502-107473524 TGTAATATAATTTCAACAAATGG + Intronic
1113997597 14:16101078-16101100 TGTAATGGAATACAATCAAATGG - Intergenic
1114835352 14:26197262-26197284 TGTAATTAAATATAACAACATGG + Intergenic
1114963868 14:27931855-27931877 TGTAGTGAAATAGAACAAAATGG - Intergenic
1115030672 14:28789623-28789645 TGTAATGAGATATGATTAAAGGG - Intronic
1115188195 14:30716838-30716860 TGTAATAAAACATCTCAAAAGGG + Intronic
1115896868 14:38099020-38099042 TATAATGCAATATCACAAAAAGG - Intergenic
1116242070 14:42356540-42356562 TGGAATGACATGTCACCATATGG + Intergenic
1116633938 14:47369168-47369190 TTTAATGATATATCACTAAGGGG - Intronic
1117122381 14:52582031-52582053 TGTAATAAAATATCATAAACTGG + Intronic
1119136224 14:72223308-72223330 TGTAATGATTTAAAACCAAATGG + Intronic
1119901840 14:78267376-78267398 TGTAAAGACATTTCACCATATGG - Intronic
1120290143 14:82558784-82558806 TGTTATGAAATATTATCAAATGG + Intergenic
1120746755 14:88159257-88159279 TGTAAACAAAGTTCACCAAAGGG - Intergenic
1121564353 14:94897405-94897427 TGCAATGAAATATCAGGGAAAGG + Intergenic
1121853974 14:97249436-97249458 TGCCATGAAATATCAGAAAAAGG - Intergenic
1121926864 14:97934917-97934939 TGTAATAAATTATCACCAACTGG - Intronic
1121960859 14:98258171-98258193 TGTAATGAAATAGCACAGACTGG + Intergenic
1122376383 14:101262370-101262392 TGTAATAAAATAACACAAACTGG - Intergenic
1123579953 15:21705911-21705933 TTTACTGAAATATCACTAGAAGG - Intergenic
1123616601 15:22148533-22148555 TTTACTGAAATATCACTAGAAGG - Intergenic
1126665909 15:51076516-51076538 CGTAAAGAAGTACCACCAAAAGG + Intronic
1127045771 15:55023952-55023974 TGTAATGAACTACCACAAACTGG - Intergenic
1128888824 15:71312581-71312603 CGTAATGAAATATCACAGAGTGG - Intronic
1131564779 15:93476269-93476291 TGTAACAAAGTATCACAAAATGG - Intergenic
1131633109 15:94200804-94200826 TACAATGAAAAATCAGCAAAGGG + Intergenic
1132153596 15:99479459-99479481 GGTAATGAAAAAGCACCAGATGG + Intergenic
1202988823 15_KI270727v1_random:440156-440178 TTTACTGAAATATCACTAGAAGG - Intergenic
1133180655 16:4051662-4051684 GGTAATGAATTATAACCCAATGG + Intronic
1133779594 16:8927384-8927406 TGGTATGAAATTTCTCCAAATGG + Intronic
1135482723 16:22834941-22834963 TGGAAAGAAATATCTCCAACAGG - Intronic
1136941690 16:34591062-34591084 TGAAATGAATTGTCATCAAATGG - Intergenic
1136954571 16:34766179-34766201 TGAAAAGAATCATCACCAAATGG - Intergenic
1137093768 16:36227056-36227078 TGAATGGAAATATCATCAAATGG - Intergenic
1137095146 16:36245326-36245348 TCGAATGGAATATCAGCAAATGG - Intergenic
1137331069 16:47497001-47497023 TGTAATGAAACATTAGCATAAGG + Intronic
1137908848 16:52354859-52354881 TGTCTTGAATTCTCACCAAATGG + Intergenic
1138042020 16:53681942-53681964 TGTAGAGAAAAATCACAAAATGG - Intronic
1138158917 16:54735095-54735117 TTTAATGAAATATCATCAATTGG - Intergenic
1138812653 16:60169078-60169100 TGATATGAAATATCCACAAAAGG - Intergenic
1139736608 16:68995249-68995271 TGTAAGGTAATATAACCAAGAGG - Intronic
1141512680 16:84522884-84522906 TGTAACAAAGTATCACCAACTGG + Intronic
1141697383 16:85626496-85626518 GGTAATGAAAAATTACCAAGAGG + Intronic
1203105594 16_KI270728v1_random:1353662-1353684 TATAATGCAAAATCACCTAAAGG - Intergenic
1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG + Intergenic
1144335240 17:14262747-14262769 TCTAATTAAATATTACCATAAGG - Intergenic
1144379632 17:14681454-14681476 GTTGATGAAATATTACCAAAAGG - Intergenic
1144571576 17:16403264-16403286 TATAATGAAGCATCTCCAAAGGG + Intergenic
1145330471 17:21867643-21867665 TCAAAAGAAATATAACCAAATGG + Intergenic
1145336019 17:21913243-21913265 TCGAATGAAATGTCATCAAATGG + Intergenic
1145337000 17:21921559-21921581 TGTAATGGAATGGCATCAAATGG + Intergenic
1145338515 17:21933609-21933631 TGGAATGGAATAGAACCAAATGG + Intergenic
1145342445 17:21966750-21966772 TCTAATGGAATATAATCAAATGG + Intergenic
1145697703 17:26802403-26802425 TCGAATGGAATATAACCAAATGG + Intergenic
1145700695 17:26827579-26827601 TGGAATGGAATGTAACCAAATGG + Intergenic
1145705620 17:26869061-26869083 TGTAATCAAATATAATGAAATGG + Intergenic
1146120926 17:30193722-30193744 TGTAATGATATATCAGTAACAGG + Intergenic
1146175069 17:30660764-30660786 TGTAAAGAAATATCAAAGAATGG + Intergenic
1146348523 17:32076788-32076810 TGTAAAGAAATATCAAAGAATGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147059210 17:37860849-37860871 TGTAACAAAATATCACAAACTGG - Intergenic
1149346628 17:55743753-55743775 TGTAATTCAAAAACACCAAAAGG + Intergenic
1150010550 17:61498644-61498666 TTTAGTGAAATACCACCAAAAGG - Intergenic
1150187243 17:63196127-63196149 TGTAATGTAATATCAGTTAATGG - Intronic
1150567510 17:66354856-66354878 TACAAAGAAATATCACAAAAAGG - Intronic
1150734226 17:67722663-67722685 TTTAAAGAAATTTCACAAAATGG - Intronic
1151103018 17:71577287-71577309 TATAATAAATTATCACCAACTGG - Intergenic
1151162371 17:72176220-72176242 TGTTTTTAAATATCCCCAAATGG - Intergenic
1151171791 17:72252808-72252830 CGCAAAGTAATATCACCAAAAGG + Intergenic
1203181151 17_KI270729v1_random:57841-57863 TGGAATGGAATTTAACCAAATGG + Intergenic
1152997147 18:418315-418337 TTTAAAGAAATATCACCATTTGG - Intronic
1153860735 18:9202482-9202504 TATAATGAAATATCAGGAAGGGG - Intronic
1154929781 18:20981091-20981113 GGTAAAGAAATATCCACAAAAGG + Intronic
1155474513 18:26224890-26224912 TATAATGAAATATCATAAACTGG + Intergenic
1155536333 18:26822038-26822060 CCTAATTAAATATCACCAGAGGG + Intergenic
1157057130 18:44243592-44243614 TTTAATGAAATATTACCCAAAGG + Intergenic
1157231988 18:45925986-45926008 TGTAAAAAAATTTCTCCAAAAGG + Intronic
1157252750 18:46110040-46110062 TGAAATCAAATAGCCCCAAATGG - Intronic
1157654242 18:49369650-49369672 TCCAATAAAATATCAGCAAAGGG - Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1159049009 18:63399464-63399486 TTTAATCAAATATCACCTTACGG + Intronic
1159188528 18:65011280-65011302 TGCAATGAAATATCCACATACGG - Intergenic
1160223592 18:76995004-76995026 TGTAATGACCTATCACTAAAAGG + Intronic
1160349582 18:78165104-78165126 TGTAATAAAATAACATAAAAAGG - Intergenic
1161309034 19:3583785-3583807 TGAAATGAAATATCAGCAGGGGG + Intergenic
1161809302 19:6462701-6462723 AGAAAAGAAATATAACCAAATGG - Intronic
1164214957 19:23136256-23136278 TGTAAAGTAAGATTACCAAAGGG - Intronic
1166631037 19:44408105-44408127 TGAAATGAAAAATGACGAAAAGG + Intergenic
1166826722 19:45614409-45614431 TGTAATAAAATGAAACCAAATGG - Intronic
925529858 2:4847421-4847443 TGCAATGAAATATTATGAAAAGG + Intergenic
926005116 2:9367438-9367460 TTTAATGAAATAATACCAAAAGG - Intronic
928555492 2:32420049-32420071 GGTAATGCATTATGACCAAATGG - Intronic
928810838 2:35223509-35223531 TGTAAAGAAATAGAACCAATGGG - Intergenic
929104797 2:38354255-38354277 TGAAATGAAACATTATCAAATGG + Intronic
929316463 2:40484852-40484874 TGTAATGAAATCTCAGCAGAAGG + Intronic
930307154 2:49689156-49689178 TGTAGTGTAATATCACCAGCAGG + Intergenic
930450656 2:51533303-51533325 TGAAAGGAAGTAACACCAAATGG - Intergenic
930748997 2:54914423-54914445 TGAAATGTAATTTAACCAAATGG + Intronic
931173421 2:59829145-59829167 TGGTATTAAATATCACCAACGGG + Intergenic
931338611 2:61375990-61376012 TTAAATGAAATATCTCAAAATGG + Intronic
932521285 2:72416163-72416185 TCTAATGAAATGTAAACAAAAGG - Intronic
932885665 2:75547076-75547098 TATAATAAAATATCACAAATTGG - Intronic
933019992 2:77177930-77177952 TGTAATAAAAGTTCCCCAAAAGG - Intronic
933470559 2:82717524-82717546 TTTAACAAAATATCACCAACCGG - Intergenic
933888154 2:86739620-86739642 TGTAAAGCAAAATCACCAAAGGG + Intronic
933922024 2:87057086-87057108 TGTAAAGCAAAATCACCAAAGGG - Intergenic
934192829 2:89815305-89815327 TGGAATGGAATATGATCAAATGG - Intergenic
936262587 2:110974439-110974461 TATAATTAAATTTCACCAAGGGG - Intronic
936760098 2:115767654-115767676 TGTAATTAAAAATTATCAAATGG + Intronic
936881514 2:117257413-117257435 TGTAATATAATTTCACCAGATGG - Intergenic
937269054 2:120635986-120636008 TGTAATGAATGATCACAAACTGG - Intergenic
937736043 2:125291226-125291248 TTCAATGATATATCAACAAAGGG - Intergenic
938189188 2:129259443-129259465 GCTAATGAAATATCATCACAGGG - Intergenic
938775557 2:134538391-134538413 TGTAATGAAATATCATAGACTGG - Intronic
941322725 2:164075358-164075380 TGAAATGAAATATCAACATCAGG - Intergenic
941348851 2:164406277-164406299 TGTAATGAAATGTCATTAACTGG - Intergenic
943168594 2:184366274-184366296 TGGAATGAACTAACAGCAAATGG + Intergenic
943311535 2:186331552-186331574 TGTAAAGACATATAGCCAAAGGG - Intergenic
944358877 2:198827475-198827497 TGGAATGAAATGGCACCAAAAGG + Intergenic
944430529 2:199628676-199628698 TTTAATTAAATATCTCCAAAAGG + Intergenic
947127461 2:226885383-226885405 TGTAATGATGTATCAGAAAATGG + Intronic
947929591 2:233952632-233952654 TGTAATGGGATATCATTAAAAGG + Intronic
948073668 2:235148162-235148184 TGTAATGGAATATTACCCAAAGG - Intergenic
948638974 2:239361079-239361101 TAGAATGAAATATCAGAAAAAGG - Intronic
948654203 2:239466558-239466580 TGTCATGCAATGTCCCCAAATGG - Intergenic
1169855794 20:10101252-10101274 TGTAGTGTAATATCACAACAAGG - Intergenic
1170879288 20:20280421-20280443 TGTAATGAAGTACCACAAACTGG - Intronic
1171055408 20:21901873-21901895 TGTAACGCATTATCACCCAATGG + Intergenic
1171921480 20:31102339-31102361 TGGAATGAAATTTACCCAAACGG + Intergenic
1171921964 20:31106306-31106328 TCAAATGGAATATCATCAAATGG + Intergenic
1171929986 20:31220504-31220526 TGGAATGAAATTTACCCAAACGG + Intergenic
1171930458 20:31224427-31224449 TCAAATGGAATATCATCAAATGG + Intergenic
1173749126 20:45462609-45462631 TGTAACAAAATACCACCAACTGG - Intergenic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1176211631 20:63926126-63926148 TGTAATAAAAAATCCCCAGAAGG - Intronic
1177002035 21:15625160-15625182 TGTAATGAAAGATGGCCATAAGG + Intergenic
1177105746 21:16953442-16953464 TGTAATGAAATACCACAGACTGG - Intergenic
1177172282 21:17667841-17667863 TGTCATCAGATCTCACCAAAAGG - Intergenic
1177220456 21:18185681-18185703 TGTAATAAAATATCACAGACTGG + Intronic
1177289437 21:19091734-19091756 TATAATAAAATATCACCAACTGG - Intergenic
1177398307 21:20566719-20566741 TGTCATGCAACATCAGCAAAGGG + Intergenic
1177572476 21:22904765-22904787 TGTAATGAAATCTCAGCATTTGG + Intergenic
1177998601 21:28132927-28132949 TGTAGTGAGATATCCCCAAGGGG + Intergenic
1178123541 21:29493637-29493659 TGCCTTAAAATATCACCAAAAGG - Intronic
1178210523 21:30526267-30526289 TGTGCGGAAATATCATCAAAGGG + Intergenic
1178228253 21:30750151-30750173 TGTAATGAAATATTATAAAAAGG - Intergenic
1178512042 21:33213674-33213696 TATAATAAAATACCATCAAATGG + Intergenic
1178704544 21:34862418-34862440 TGTAATAAATTATCACAAACTGG + Intronic
1179085504 21:38213281-38213303 TGAAATGCAAGCTCACCAAAAGG - Intronic
1179184318 21:39072762-39072784 TGTAATAAAATGCCACCAACTGG - Intergenic
1179193558 21:39143792-39143814 TATAAAGAAATCTAACCAAAGGG - Intergenic
1179328444 21:40374461-40374483 TGTGGTGAAATAGCTCCAAATGG - Intronic
1180114710 21:45693809-45693831 TGAAAGGAAATATTCCCAAATGG + Intronic
1180233269 21:46440986-46441008 TGGAAGGAAATACCCCCAAATGG - Exonic
1180529725 22:16338769-16338791 TGGAATGGAATATCATCAAATGG - Intergenic
1180690643 22:17712324-17712346 TGTAATGTAATGTCACTAACAGG - Intronic
1181309302 22:21935437-21935459 TATAATAAAATATCACCACCAGG - Intronic
1181338065 22:22155902-22155924 TGATCTGAAATATCACCACAGGG + Intergenic
1182539340 22:31028873-31028895 TATAATTAAAAATCACCAACTGG + Intergenic
1183884755 22:40870026-40870048 TCTGATGAAAAATCAGCAAAAGG - Intronic
1203305849 22_KI270736v1_random:108597-108619 TGGAATGAAATATAATGAAACGG + Intergenic
1203319923 22_KI270737v1_random:47042-47064 TGGAATGGAATATCATCAAATGG + Intergenic
1203327835 22_KI270738v1_random:44671-44693 TCGAATGGAATATCATCAAATGG + Intergenic
1203328270 22_KI270738v1_random:50697-50719 TCGAATGGAATATCATCAAATGG + Intergenic
949551454 3:5115548-5115570 TGTAATGAAGTACCACTAATTGG + Intergenic
951181706 3:19666950-19666972 TGCAAAGAAATATCACCATTGGG + Intergenic
951791712 3:26492840-26492862 TGTAATGAGATGTAAGCAAAAGG - Intergenic
952518925 3:34135107-34135129 TGTAATAAACCATCACCAAGTGG + Intergenic
952655629 3:35781976-35781998 TGTAATGAAATGTAAACAAGTGG + Intronic
953699760 3:45186658-45186680 TGTAATGAAATATCCGGAATAGG + Intergenic
954502923 3:51037806-51037828 TGTAATGAAATACCATAAACTGG - Intronic
955185035 3:56707308-56707330 TGAAATAAAATAATACCAAATGG + Intergenic
955387262 3:58489634-58489656 CTAAATGAAATATCAGCAAATGG + Intergenic
955699547 3:61670434-61670456 TTTAAACAAATATCACAAAATGG - Intronic
956116326 3:65922655-65922677 TGTAATAAAATATCACAAACTGG - Intronic
956211791 3:66809187-66809209 TGGAATGGAATTTCACCAAAAGG - Intergenic
956229338 3:66997110-66997132 TGTAAGGAAGTATCAGCGAATGG - Intergenic
956245397 3:67176794-67176816 TTTTATAACATATCACCAAAAGG + Intergenic
957429932 3:80090808-80090830 ATTTATAAAATATCACCAAATGG + Intergenic
957461503 3:80526978-80527000 TGTAATAAAATATCATAAACTGG - Intergenic
957545064 3:81626351-81626373 TGCAATGAAATAGCTCCTAAAGG + Intronic
957693443 3:83601162-83601184 TCTAATAAAAAATAACCAAAAGG + Intergenic
958680684 3:97327392-97327414 TGTAGTGAAATATCACAACCAGG + Intronic
959623872 3:108427557-108427579 TGTAATGAAATACCACAGACTGG - Intronic
960700584 3:120435467-120435489 TGTAATGAACTGTCCCCAAATGG - Intronic
962061655 3:131934372-131934394 TGTTATAAAATGTCACTAAAAGG + Intronic
963506355 3:146189810-146189832 TGTAATGAAAGAAAACCAAAGGG - Intergenic
964089354 3:152856002-152856024 TATAATAAAATATCACAAACAGG - Intergenic
964148061 3:153490322-153490344 TCTCATGAAATTTAACCAAAAGG - Intronic
964170043 3:153759037-153759059 TGTAATGAAAAATCCTCAGAAGG + Intergenic
964458105 3:156891326-156891348 TGGAATGATATAACCCCAAAAGG - Intronic
964728099 3:159836160-159836182 TGTAATAAAATATCATAAACTGG + Intronic
965011006 3:163090966-163090988 TGTCATGACTTATCCCCAAACGG - Intergenic
965565111 3:170107645-170107667 TTTAATGCAATATAACTAAAAGG - Intronic
965771443 3:172185879-172185901 TGTATTGAATTTTCACCAAATGG + Intronic
966083928 3:176043493-176043515 TGTAACAAAATATCATAAAATGG + Intergenic
967125451 3:186419253-186419275 GATAATGAAATATCATTAAATGG + Intergenic
967193047 3:187001655-187001677 TGTAATGAAAAACAAACAAACGG + Intronic
967617144 3:191583613-191583635 TGAAGTGCAATAGCACCAAATGG - Intergenic
969784800 4:9447979-9448001 TGTAATGAAATATCAGGAGGAGG + Intronic
971754480 4:30689691-30689713 TATAATGTAATATGACAAAATGG - Intergenic
972033420 4:34491859-34491881 TGTACTCAAATATGAACAAAAGG + Intergenic
972225729 4:37009369-37009391 TTTACTGAAATATCAGCAAATGG + Intergenic
973147354 4:46844032-46844054 TGTAAGGAAATATCAACATTTGG + Intronic
973324704 4:48847213-48847235 TGAAATGAAGTATAAACAAATGG - Intronic
973624056 4:52753199-52753221 TGTAAAGAAACATCAATAAAAGG - Intergenic
974712090 4:65611218-65611240 TATATTGAAATATCACTAAAAGG - Intronic
974870840 4:67638786-67638808 TATAATGAGAAATCATCAAAGGG + Intronic
975586206 4:75952599-75952621 GACACTGAAATATCACCAAAGGG + Intronic
976091941 4:81467766-81467788 TGTAAGGCATTATGACCAAATGG - Intronic
976285955 4:83371286-83371308 TGTAATGAAGTGTCACCAACTGG + Intergenic
977328987 4:95612798-95612820 TTTAATGAAATATAATCCAAAGG + Intergenic
977909528 4:102516538-102516560 TGAAATGAAATTTCACTAGATGG - Intronic
978063767 4:104370882-104370904 TGTAAAGAAAGCTCACCACATGG + Intergenic
978483598 4:109224269-109224291 TGAAAGGAAATATCAAAAAAAGG + Intronic
978755123 4:112293490-112293512 TGTAGTTAGATATTACCAAAGGG - Intronic
978958233 4:114640928-114640950 TCTTAGAAAATATCACCAAAAGG + Intronic
978988916 4:115053071-115053093 TGTGCTGAAATATCAATAAATGG + Intronic
979349889 4:119631093-119631115 TGTAATAAAATATCACAGACTGG - Intergenic
979708830 4:123753081-123753103 TGCAAAGCAATATCAACAAAAGG - Intergenic
980261466 4:130454860-130454882 TTTAACGAAATATAAGCAAATGG + Intergenic
983374380 4:166905948-166905970 ATTAATGAAATATAACTAAATGG + Intronic
983611957 4:169656425-169656447 TATAATGAGATAGCACCAAGTGG + Intronic
983814433 4:172105543-172105565 TGCAATGCAATTTCACCATAAGG - Intronic
983816274 4:172130855-172130877 TGTAATGAAATATCTCTTTATGG - Intronic
984291712 4:177804026-177804048 TGTAATCAAATCTACCCAAAGGG - Intronic
985118369 4:186615167-186615189 TGTACTGAAATAATATCAAAGGG + Intronic
986122629 5:4856054-4856076 TGTAATGAAATGTGACCCACTGG - Intergenic
986825869 5:11521920-11521942 TGTAATCAGTTATCAGCAAAAGG - Intronic
987767638 5:22254538-22254560 TGCAATGAAATATAACTAATGGG + Intronic
987926009 5:24342811-24342833 TTTAATGAAATATCATTGAAAGG + Intergenic
987992340 5:25229720-25229742 AGAAATGAAATATTACCTAATGG + Intergenic
988360853 5:30234772-30234794 TGTTATGAACTATAACCTAAAGG - Intergenic
988583056 5:32485141-32485163 TGAAAGGAAAAATCAACAAAAGG - Intergenic
990444614 5:55882446-55882468 TGAAAGGAAATATAACAAAATGG + Intronic
990771105 5:59246558-59246580 TGTAAAAACATATCACCAGATGG + Intronic
991497952 5:67245983-67246005 TGTAACTAAAAATCAACAAAAGG - Intergenic
993036358 5:82761691-82761713 TTTAATTCAATATCACCACAAGG - Intergenic
993461812 5:88191485-88191507 TTTACTGAAAAATAACCAAATGG + Intronic
994073218 5:95623666-95623688 TGGCATGAAGGATCACCAAATGG + Intergenic
994869210 5:105322929-105322951 TATAATGAAACATTAACAAAAGG - Intergenic
996210978 5:120809493-120809515 TGTTATCAAATATCTCAAAATGG + Intergenic
996923580 5:128797081-128797103 TGTACTTAAATATTACAAAAAGG + Intronic
998737483 5:145159152-145159174 TATAAATAAATATCAGCAAATGG + Intergenic
1000057236 5:157618187-157618209 TAAAGTGAAATATCACTAAAAGG + Intergenic
1001521066 5:172393790-172393812 TCAAATGAAATATAACCAAAAGG + Intronic
1001620503 5:173080884-173080906 AGAAATGAGATATCACAAAAAGG - Intronic
1004335137 6:14757539-14757561 TGTAATGAAGTACCACAAATTGG + Intergenic
1005083923 6:21984021-21984043 TGCTATAAAATATCACCATAGGG + Intergenic
1005341669 6:24849298-24849320 TGAAATAGAATATCCCCAAAGGG - Intronic
1005351349 6:24938438-24938460 TGTAATGAAGTACCACAAACTGG - Intronic
1005897681 6:30191929-30191951 TGTCAGGAAATATGCCCAAATGG - Intronic
1006282485 6:33065960-33065982 TTTAATGAAATATCTTGAAAAGG - Intronic
1006320858 6:33318623-33318645 TTTAAAGAAACACCACCAAAAGG + Exonic
1008337298 6:50322956-50322978 TGAAATGAACTATCACTAATGGG - Intergenic
1009358072 6:62776854-62776876 GGTAATAAAATATCAACAAAAGG - Intergenic
1009737440 6:67694678-67694700 TGTATTTAATGATCACCAAAAGG + Intergenic
1010919320 6:81662463-81662485 TGGTATGAAATATCAAAAAAAGG - Intronic
1011548356 6:88504967-88504989 TGAAATGAAATTCCACCAGATGG - Intergenic
1011839609 6:91480044-91480066 TGTAATTAAATGTCACAGAATGG - Intergenic
1012758168 6:103260014-103260036 TGGAATGAAATAGCACAAATGGG - Intergenic
1013730346 6:113157228-113157250 TGTAATAAAATATCACAAAATGG + Intergenic
1013874851 6:114812787-114812809 AGTAATGGAAGATCACTAAAAGG + Intergenic
1014947868 6:127518022-127518044 TATAAAGAAATATTACCGAAGGG + Intronic
1015075670 6:129153836-129153858 TGTAATGAATTACTACCATATGG - Intronic
1016130004 6:140456513-140456535 TATAATAAAATACCCCCAAATGG - Intergenic
1018130948 6:160732135-160732157 TTTAAAGAAATGTCACTAAAGGG - Intronic
1019781880 7:2945296-2945318 AGCAATGAAAAACCACCAAAGGG + Intronic
1021145394 7:17082401-17082423 TGAAAAGCAATATCACTAAAAGG - Intergenic
1021193948 7:17653509-17653531 TGTAACAAAGTATCACAAAATGG + Intergenic
1022116418 7:27264945-27264967 TGTAATGAAATGGAATCAAATGG - Intergenic
1022162931 7:27730106-27730128 TGTAATAAATTATCACAAACCGG + Intergenic
1022427206 7:30280531-30280553 TGTATTAAAATTTCACAAAATGG + Intergenic
1022721348 7:32943874-32943896 GGTAATGCACTATGACCAAATGG - Intergenic
1024152299 7:46584487-46584509 TGGATTGACAGATCACCAAATGG - Intergenic
1024800033 7:53066220-53066242 TATAATGAAATACCACAAACTGG - Intergenic
1025316452 7:58036926-58036948 TCGAATGGAATATCAGCAAATGG + Intergenic
1025318419 7:58062514-58062536 TTGAATGGAATATCATCAAACGG - Intergenic
1025485990 7:61049081-61049103 TGAATGGAAATATCATCAAATGG + Intergenic
1025567475 7:62454454-62454476 TCAAATGGAATATCATCAAATGG - Intergenic
1026770005 7:73190163-73190185 TTTAATAACATATCAACAAAGGG + Intergenic
1027010873 7:74743546-74743568 TTTAATAACATATCAACAAAGGG + Intronic
1027077169 7:75202494-75202516 TTTAATAACATATCAACAAAGGG - Intergenic
1028514453 7:91660740-91660762 TATAATGGAATATCACAGAATGG + Intergenic
1029042629 7:97593516-97593538 TTTAATTTCATATCACCAAAAGG - Intergenic
1029352612 7:100025207-100025229 TGTCATGAATTATCTTCAAAAGG + Intronic
1030266168 7:107624286-107624308 TCTCATGAAATGTCACCAACAGG - Intronic
1031061345 7:117054840-117054862 TGTAAAGAAATATCATGAGATGG - Intronic
1031178096 7:118378213-118378235 TGTAATAAAATATCACAAACGGG + Intergenic
1031451976 7:121932680-121932702 TGTAATGTAATATTTCTAAATGG - Intronic
1031529764 7:122862360-122862382 TGTGATGACATTTCACAAAAAGG - Intronic
1037662941 8:20942685-20942707 TGTAATGTACTATCTACAAATGG - Intergenic
1038158938 8:25018309-25018331 TGTAAGGAAATACCACCAAGTGG - Intergenic
1038261580 8:26000727-26000749 GGAACTGAAATATCAACAAAAGG + Intronic
1040696648 8:50007469-50007491 GTTAATGAAATATCACTGAAGGG - Intronic
1041289733 8:56297375-56297397 TGTGATGAAATCTGACCAATAGG + Intergenic
1041879556 8:62733951-62733973 TGGGATGAAAAATCACTAAAGGG - Intronic
1042227143 8:66522832-66522854 TGTCATGAAAAATCCCCAAGAGG + Intergenic
1043395962 8:79836758-79836780 TGTAACAAAATATTAGCAAATGG + Intergenic
1043647592 8:82540256-82540278 TGTAATGAAAATTCACAAAATGG - Intergenic
1044141618 8:88660799-88660821 TTCAATGAAATATTTCCAAAAGG + Intergenic
1046691989 8:117295746-117295768 TGTATTGAGATGTCCCCAAAAGG - Intergenic
1046839190 8:118838645-118838667 TGTAAGAAAATATCACAAACTGG + Intergenic
1046981455 8:120340896-120340918 TTTAAAGGAATATCTCCAAAAGG - Intronic
1047084249 8:121498557-121498579 TGGGATGAAATATAAGCAAAGGG + Intergenic
1047356039 8:124123164-124123186 TTAAATGAAAAAGCACCAAATGG - Intergenic
1047581008 8:126215390-126215412 TGTAATTAAATATCACACATTGG + Intergenic
1048051202 8:130818558-130818580 TGTAATTAAACATCTCCAGAGGG - Intronic
1048222967 8:132560442-132560464 TGTAAAGCAAAATCAGCAAAAGG + Intergenic
1049969159 9:806431-806453 TGTAACGAAATATCACAGACTGG - Intergenic
1050280215 9:4042727-4042749 TGTAGGGAAATATAAACAAATGG + Intronic
1050794102 9:9514867-9514889 TTTAATGAGAGACCACCAAAGGG - Intronic
1050866901 9:10512256-10512278 AGTAATGAAATGTCACAAATAGG + Intronic
1051784542 9:20728002-20728024 TGTAATGAAATAATTCCCAAAGG + Intronic
1052367466 9:27628983-27629005 AAGAATGAAATATCTCCAAAAGG + Intergenic
1053389347 9:37723102-37723124 TGTAATGAAATATCACCAAAGGG - Intronic
1053535575 9:38922460-38922482 TGTCATGTAATATCACGAACTGG + Intergenic
1055072340 9:72179654-72179676 TGTAATGAAGTACCACAAACAGG + Intronic
1055279729 9:74660645-74660667 TGTATTGACATGTCTCCAAATGG - Exonic
1057103631 9:92388974-92388996 TGTAATGAAAAATGAAAAAATGG + Intronic
1059970614 9:119664208-119664230 TTTAAGGACATGTCACCAAAAGG + Intergenic
1060177499 9:121507837-121507859 TGTAAAGAAATAGCTCCAATTGG - Intergenic
1060573942 9:124671367-124671389 TAAAATGAGTTATCACCAAATGG + Intronic
1203348005 Un_KI270442v1:48985-49007 TGTAATCAAATGTAATCAAATGG + Intergenic
1186268373 X:7857628-7857650 TATAATGAAATATCATAAACTGG + Intergenic
1186322939 X:8450222-8450244 TGTGATTAAATATCAGGAAAAGG + Intergenic
1187354574 X:18555052-18555074 TGTACGGAAATACCACAAAATGG + Intronic
1187776159 X:22760444-22760466 TGTAATAAAATACCACAAACTGG - Intergenic
1188310816 X:28614381-28614403 TTTAATGAAATATCTGCTAAAGG - Intronic
1189061505 X:37758315-37758337 TATAATAAAGTATCACCAACTGG + Intronic
1189236408 X:39490554-39490576 TGTAACAAAATATCACAAACTGG - Intergenic
1190412436 X:50150541-50150563 TGGAATGAAATTTCACCAGAGGG + Intergenic
1191199698 X:57766506-57766528 TGCAATGACATATTTCCAAAGGG - Intergenic
1194428290 X:93767206-93767228 TATAATGAAATATCAGGAAAAGG + Intergenic
1194461158 X:94169819-94169841 GCCAATGAAATATCACCACAGGG - Intergenic
1194701820 X:97122978-97123000 GGTAATGAATTATGAACAAATGG - Intronic
1195081110 X:101371703-101371725 TGTAATGAAATAAGAAAAAATGG + Intronic
1195340718 X:103904027-103904049 TTAAATGAAAAATCACTAAATGG + Intergenic
1195450051 X:105001079-105001101 TGTACTGAAATTTAAGCAAATGG + Intronic
1197878113 X:131133199-131133221 TGTAATAAAGTACCACAAAATGG - Intergenic
1198015648 X:132607901-132607923 TGGAAGGAAATATAACAAAATGG + Intergenic
1198142524 X:133818957-133818979 AGTAGAGAAAAATCACCAAAAGG - Intronic
1198727876 X:139696094-139696116 ATTAATGAAATAATACCAAAGGG - Intronic
1199499137 X:148490144-148490166 TCAAATGAAATATCAAAAAATGG - Intergenic
1199566379 X:149219795-149219817 TGTAATGATGTATCACAAACTGG + Intergenic
1201211547 Y:11685356-11685378 TGGAATGGAATATAATCAAATGG + Intergenic
1202607767 Y:26653519-26653541 TGTAATCAAATGCCATCAAATGG + Intergenic
1202608085 Y:26656020-26656042 TGGAATTAAATGTCACGAAAAGG + Intergenic