ID: 1053392469

View in Genome Browser
Species Human (GRCh38)
Location 9:37745717-37745739
Sequence GAGGCACCTAACCATGTGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053392463_1053392469 3 Left 1053392463 9:37745691-37745713 CCGTCCCTCCAGAGGGGATCAAG 0: 1
1: 0
2: 1
3: 18
4: 140
Right 1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG 0: 1
1: 0
2: 0
3: 3
4: 78
1053392466_1053392469 -2 Left 1053392466 9:37745696-37745718 CCTCCAGAGGGGATCAAGGCAGA 0: 1
1: 0
2: 1
3: 19
4: 175
Right 1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG 0: 1
1: 0
2: 0
3: 3
4: 78
1053392468_1053392469 -5 Left 1053392468 9:37745699-37745721 CCAGAGGGGATCAAGGCAGAGGC 0: 1
1: 0
2: 1
3: 27
4: 249
Right 1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG 0: 1
1: 0
2: 0
3: 3
4: 78
1053392462_1053392469 7 Left 1053392462 9:37745687-37745709 CCAGCCGTCCCTCCAGAGGGGAT 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG 0: 1
1: 0
2: 0
3: 3
4: 78
1053392465_1053392469 -1 Left 1053392465 9:37745695-37745717 CCCTCCAGAGGGGATCAAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053392469 Original CRISPR GAGGCACCTAACCATGTGAC AGG Exonic
905776262 1:40669167-40669189 GAGGGAACTAACCATGTTCCAGG + Intergenic
910710869 1:90178953-90178975 GAGCCACTTAACCATGTAATAGG + Intergenic
919048207 1:192480571-192480593 GAGGCACCCACCCACGGGACTGG + Intergenic
1071017698 10:81017768-81017790 TTGGGACCTAACCATGTAACTGG + Intergenic
1077421191 11:2450826-2450848 GAGGCATCTGACCATGTGATAGG + Intronic
1086109918 11:83188767-83188789 GAGGCATCTAACCATGCTGCAGG + Intergenic
1093278529 12:17160034-17160056 GCTGCACCTAATGATGTGACAGG - Intergenic
1093898707 12:24605421-24605443 AAGCAACCTAACAATGTGACAGG - Intergenic
1100685640 12:96983817-96983839 GAGGAACCTAAGCATGGGAGTGG - Intergenic
1104522295 12:129486825-129486847 GGGGCACCTAGCTATGTGGCAGG + Intronic
1104561051 12:129844893-129844915 GAGTCACCTATTCATGAGACAGG + Intronic
1105326477 13:19374776-19374798 GAACCACCTAACCGTGGGACTGG + Intergenic
1105867031 13:24470210-24470232 GAACCACCTAACCGTGGGACTGG - Intronic
1107315219 13:39124098-39124120 GAGCCACAGAACCATGAGACAGG - Intergenic
1109561995 13:64061834-64061856 GACACACAAAACCATGTGACAGG + Intergenic
1121251892 14:92505769-92505791 GAGGCACCAGGCCAGGTGACAGG - Intergenic
1126648101 15:50895035-50895057 GAGGCACCTAAGCTTGTTAATGG + Intergenic
1127791930 15:62405848-62405870 GGGGCACTCAAACATGTGACAGG - Intronic
1130681301 15:85999224-85999246 GAGGCACATACCCCTGTGGCTGG - Intergenic
1140725882 16:77811716-77811738 AAGGCACCTAACCATCTCTCAGG + Intronic
1143913348 17:10270561-10270583 GAGGCAACTGTTCATGTGACTGG + Intergenic
1148215188 17:45830351-45830373 GAGGCACCAAACCCTGGGCCTGG - Intronic
1148226147 17:45899042-45899064 GGGGCACCTCAGCAGGTGACGGG + Intronic
1156491188 18:37497219-37497241 GACCCAACAAACCATGTGACTGG + Intronic
1162712226 19:12603974-12603996 CAGGGAACCAACCATGTGACTGG + Intronic
1163030770 19:14542765-14542787 CATGCAGCTAACCATGTAACTGG - Intronic
1164088030 19:21921830-21921852 GAGTCACATAACCTAGTGACTGG - Intergenic
1164108806 19:22135492-22135514 GAGTCACATAACCTAGTGACTGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1165249798 19:34520695-34520717 AAGGCCCCTAACCATCTGAACGG - Intergenic
933535423 2:83566744-83566766 AAGGCCCCTAACCATCTGAATGG - Intergenic
936417020 2:112325014-112325036 GACTCACCTAACCATGGGAGTGG + Exonic
939521436 2:143235968-143235990 GAGGCACCTGACCATGTTCATGG + Intronic
943185386 2:184599462-184599484 GAGGCAGGGAACCATGTGGCTGG + Intronic
943989435 2:194668697-194668719 AAGCAACCTAACCATGGGACTGG + Intergenic
1169006117 20:2208254-2208276 GAGGCAGCTTACTATGTGCCTGG - Intergenic
1169527956 20:6450867-6450889 CAGGCATCTAACCACCTGACGGG - Intergenic
1174425290 20:50427845-50427867 CAGGCACCCCACCATGTGACAGG + Intergenic
1177742682 21:25172934-25172956 GAGGCATCTATCCAAGTGAGAGG + Intergenic
1179121043 21:38546072-38546094 GAGACACCTAAACAGCTGACTGG - Intronic
1180596666 22:16979778-16979800 CAGGCACCAAAACATGGGACTGG + Intronic
1184107188 22:42374844-42374866 TAGGCATTTAACCATCTGACAGG + Intergenic
1184817638 22:46884315-46884337 GAGGCAGCTAAGCAGGTGCCTGG + Intronic
959516392 3:107271766-107271788 GGGACAACTAAACATGTGACAGG - Intergenic
966137296 3:176713475-176713497 GGGCTACCTAACCATTTGACAGG + Intergenic
971189772 4:24416397-24416419 GAGGCACGGGACCATGTGAGAGG + Intergenic
983926577 4:173409356-173409378 GAGGCAGCTAAGCATCTGAAGGG - Intergenic
985563824 5:605269-605291 GAGGCACCTCACATTGTGAGAGG + Intergenic
985563830 5:605310-605332 GAGGCACCTCACATTGTGAGAGG + Intergenic
985563899 5:605650-605672 GAGGCACCTCACATTGTGAGAGG + Intergenic
988135887 5:27171378-27171400 GAGGCACATAAAACTGTGACGGG - Intergenic
995793312 5:115916639-115916661 GAGGCCCCTAAACATCTGACTGG - Intergenic
1000354590 5:160381786-160381808 TAGGCATCTAACCATGGGATAGG + Intergenic
1001722684 5:173869481-173869503 GAGGCAGCCAGCCCTGTGACTGG + Intergenic
1004642120 6:17525657-17525679 GAAGCACTTAACCATGTTTCAGG + Intronic
1011871957 6:91906451-91906473 GAGGAACCTGAAAATGTGACTGG - Intergenic
1012549350 6:100453473-100453495 GAGGCCCCTAACCAAGGGAGGGG - Intronic
1014094317 6:117443566-117443588 GTGGCAGCTAAGCATTTGACAGG + Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017571229 6:155747251-155747273 GAGGCACATGCCCATATGACTGG + Intergenic
1018738387 6:166707454-166707476 GAGGAACAAAACCAGGTGACTGG + Intronic
1020863683 7:13527745-13527767 TAGGCACCTATCAATGTGCCAGG - Intergenic
1024937134 7:54721772-54721794 GAGGCACCGTGCCCTGTGACAGG + Intergenic
1029096296 7:98087448-98087470 GAGGCACCGAGGCATGAGACGGG + Intergenic
1033131276 7:138747702-138747724 GTGGCAGCTAAGCATGTGTCAGG - Intronic
1034101558 7:148455097-148455119 AAGGGACCTAACCATGTGTGAGG + Intergenic
1036685222 8:10904967-10904989 GAGGGACCTAAGCATGAGGCAGG + Intronic
1043506210 8:80905785-80905807 TAGGCACTTACCCATGTGCCAGG + Intergenic
1048637446 8:136312531-136312553 AAGGAACATACCCATGTGACTGG - Intergenic
1050695089 9:8269994-8270016 ATGGCAACTAAGCATGTGACTGG - Intergenic
1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG + Exonic
1054852440 9:69861932-69861954 GAGGGACCTAACCAAGTTATGGG - Intronic
1058909286 9:109506221-109506243 AAGCAAGCTAACCATGTGACTGG + Intergenic
1185982500 X:4795168-4795190 GAGGAACTAAATCATGTGACAGG + Intergenic
1193179995 X:78443044-78443066 GAGCCAGCTAACCAGGAGACTGG + Intergenic
1194627585 X:96243584-96243606 GCGGCACCAAAACATGTTACTGG + Intergenic
1195470156 X:105220812-105220834 AGGGCTCCCAACCATGTGACAGG - Intronic
1196858764 X:120007897-120007919 GGGGCATCTCACAATGTGACTGG + Intergenic
1200125594 X:153812738-153812760 GTGGCTCCTTACCATGTGCCTGG - Intronic
1200961299 Y:8998478-8998500 GGGGCATCTAACCTTGTAACAGG - Intergenic
1202151472 Y:21847753-21847775 GGGGCATCTAACCTTGTAACAGG + Intergenic
1202605321 Y:26634836-26634858 GAACCACCTAACCGTGGGACTGG - Intergenic