ID: 1053396300

View in Genome Browser
Species Human (GRCh38)
Location 9:37777434-37777456
Sequence ACAGGCTCTGCTTGCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053396300_1053396307 17 Left 1053396300 9:37777434-37777456 CCTTGAGAGCAAGCAGAGCCTGT 0: 1
1: 1
2: 2
3: 26
4: 251
Right 1053396307 9:37777474-37777496 CAAGACCTTAGTACCACATATGG 0: 1
1: 0
2: 1
3: 11
4: 174
1053396300_1053396309 28 Left 1053396300 9:37777434-37777456 CCTTGAGAGCAAGCAGAGCCTGT 0: 1
1: 1
2: 2
3: 26
4: 251
Right 1053396309 9:37777485-37777507 TACCACATATGGTGCAGAATAGG 0: 1
1: 0
2: 2
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053396300 Original CRISPR ACAGGCTCTGCTTGCTCTCA AGG (reversed) Intronic